1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanzania [10]
3 years ago
15

U HUCUS 13 HUU

Chemistry
1 answer:
mario62 [17]3 years ago
4 0

Answer:

The correct answer is a the central core and is composed of protons and neutrons.

Explanation:

Nucleus is present in the center of an atom.Nucleus contain positively charged particle proton along with neutron which is neutral.

      Due to the the presence of protons nucleus contain positive(+ve) charge.

You might be interested in
How many moles are in 12 gr of magnesium?
myrzilka [38]

Answer: 0.5 mole Mg

Explanation: solution:

12 g Mg x 1 mole Mg / 24 g Mg

= 0.5 mole Mg

5 0
3 years ago
What organisms appeared on Earth First?
dusya [7]
It is B because horn coals are bigger and I read it in a book
5 0
3 years ago
What are the answered to both 1 and 2
baherus [9]
By the lloks ofit you cant see it send a better picture
7 0
3 years ago
How many moles of water h2o are present in 75.0 g h2o?
nikklg [1K]
4.17 moles. Good luck! :)
7 0
3 years ago
11. What is the mass number
solniwko [45]

Answer:The mass numbr is 22

Explanation:

Mass number=number of protons+ number of neutrons....which is 10+12=22

4 0
3 years ago
Other questions:
  • By paying low wages, factory owners were able to
    9·1 answer
  • Hno3(aq)+k2so3(aq)→ express your answer as a chemical equation. identify all of the phases in your answer.
    9·2 answers
  • Please help with 4 and 5!
    15·1 answer
  • Which element is metal?
    10·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The atomic mass of boron is 10.811. What is the mass number of the most
    8·1 answer
  • How many moles of calcium atoms are in 77.4g of Ca?
    7·1 answer
  • A compound contains 29.27% carbon, 51.22% nitrogen, and 19.50% oxygen. What is the molecular formula if the molar mass is 570.5
    11·1 answer
  • In any chemical reaction, the atoms of any substance that you begin with, you must end with follows the ___
    10·1 answer
  • What type of plant is thought to be the first plant?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!