1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shtirlitz [24]
4 years ago
9

What are the missing coefficients for the skeleton equation below? cr(s) + fe(no3)2(aq) → fe(s) + cr(no3)3(aq)?

Chemistry
1 answer:
strojnjashka [21]4 years ago
8 0
SThe  missing   coefficient  for  the  skeleton   equation  below  is  as  follows

skeleton   equation

Cr(s)  +  Fe(No3)2(aq)  ------> Fe (s)   +  Cr(NO3)3  (aq)
the  missing  coefficient  are  is   as  follows

 2 Cr(s)   +  3  Fe(NO3)2  ---> 3 Fe (s)  +  2 Cr(NO3)3

This  is  obtained   by  making  sure  all  the   molecules  are  balanced  in  both  sides
You might be interested in
A moist red litmus paper is used for testing ammonia gas ,why​
yawa3891 [41]

Answer:

when the red litmus paper is placed in a jar of ammonia, the red litmus paper turns into blue as ammonia gas is basic in nature. It confirms the alkalinity of the ammonia gas.

6 0
3 years ago
Which is a positive effect of the technology advance of going from a compass to a gps
egoroff_w [7]

Answer:

Compass - Gps                              

Explanation:

I belive the pro's                                      and cons are

                                         GPS             you are trusting a little man made device

the direction you                               to give you directions

are going on                                        and that it won't break or die

a device not a paper map

                                                Compass

You can see north east south and              it is usually carefully crafted for                                                                                                                                                                          o                                                                     outdoors but it has no roads and

west on the compass and                          if given no directions, extremely

you can see the roads follow directions                  confusing until you learn it

like go south then east.

4 0
3 years ago
Is the following true or false every element in the periodic table follows the aufbau principle
gulaghasi [49]

Answer:

True

Explanation:

It is true that every element in the periodic table follows the Aufbau's principle.

The principle states that "the sublevels with lower energies are filled up before those with higher energies".

  • Sublevels do not fill up in numerical order.
  • This is true when writing the electronic configuration of all atoms on the periodic table.
7 0
3 years ago
Eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee
otez555 [7]

Answer:

<h3>option D</h3>

Explanation:

<h3>Is wire A connected to the light bulb </h3>

<h3>because it is series connection</h3>
8 0
3 years ago
Ethane reacts to form bromoethane. What is the other product in this reaction?​
Rzqust [24]

Answer:Hydrobromide HBr

Explanation:

4 0
3 years ago
Other questions:
  • A 38-lb child is prescribed acyclovir for chicken pox in an amount of 80 mg/ kg body weight per day to be divided in four doses
    9·1 answer
  • Which of the following is TRUE? Group of answer choices None of the above is true. The equivalence point is where the amount of
    8·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Find the volume of a rectangular prism that is<br> 25 cm by 10 cm by 15 cm.<br> height<br> length
    7·2 answers
  • Please help quick!!!!!
    7·1 answer
  • an electron travels in a vacuum tube that is 2 meters in length .002 seconds what is the average speed of the electron during th
    15·2 answers
  • Convert 30°C into kelvin
    7·1 answer
  • I haven't done any science assignments of the unit we are learning and I have no clue at all what it's all about...what is activ
    7·2 answers
  • MARK BRAINEIST
    10·2 answers
  • Describing Rock Texture
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!