1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KIM [24]
3 years ago
6

What dose iff mean when used in a biconditional statement

Chemistry
1 answer:
katovenus [111]3 years ago
4 0

Hello!

A biconditional statement is when one conditional statement and it's converse is true.

A conditional statement is an "If <em>hypothesis</em>, then <em>conclusion</em>" statement.

A converse statement is an "If <em>conclusion</em>, then <em>hypothesis</em>" statement.

Looking at this, both of these statements have their hypothesis and conclusion switched.

Thus, a biconditional statement is a "<em>Hypothesis</em> IFF <em>conclusion</em>." In this statement, IFF means if and only if.

Therefore, when IFF is used in a biconditional statement, it means if and only if.

You might be interested in
The substances in a chemical reaction that are combined or separated to form new substances are the _______.
katen-ka-za [31]
Reactant/ Reagents and Products
6 0
3 years ago
Read 2 more answers
Two crates, one heavy and one light, are at rest on a waxed floor. Which crate will need the greater force to give the same chan
otez555 [7]
The heavy one because mass times force is equal to speed. The lighter one has less mass to it goes faster without as much effort. I hope that helps!
4 0
3 years ago
Read 2 more answers
Why must we do the a lot of quantity urine​
serg [7]

Answer:

because

ExplanatioN:

<em>BeCaUsE</em>

7 0
2 years ago
What term refers to rows of elements
qaws [65]
Period are going left to right across the periodic table
Groups are going up to down on the periodic table
3 0
2 years ago
Read 2 more answers
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
Other questions:
  • What is the pOH of 0.50 molar H3BO3?
    9·1 answer
  • Which substance can be decomposed by chemical means?
    14·1 answer
  • If you toward the right of the periodic table is it harder or easier to remove valence electrons?​
    15·2 answers
  • How does an ionic bond form
    10·1 answer
  • In a chemical reaction how does the mass of the reactants compare with the mass of the products?
    7·1 answer
  • If 13.6 kilograms of al2o3 51.4 kilograms of naoh and 51.4 kilograms of hf react completely, how many kilograms of cryolite will
    11·1 answer
  • Mg(OH)2 + 2HNO3 → Mg(NO3)2 + 2H20
    12·1 answer
  • Elements which have high electronegativities occur in Group: IA IIA VIIA O​
    7·1 answer
  • What is the volume (ML) of water
    7·1 answer
  • Three examples of<br> solid and gas solution
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!