1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ray Of Light [21]
3 years ago
13

PLS HELP!!!!! WILL GIVE BRAINLIEST, 5 STARS, AND THANKS!!!!!!!!!!

Chemistry
2 answers:
MrRissso [65]3 years ago
4 0
Addition in elimination
Jobisdone [24]3 years ago
3 0

ITS B : Addition and elimination!

You might be interested in
Water can only dissolve inorganic compounds
mote1985 [20]
Water can only dissolve inorganic compounds is false 


4 0
3 years ago
Convert 6.0cc to cm cubed
ELEN [110]
Cc stands for cm cubed (cubic centimetre).
So
6cc=6 cm^3.
6 0
3 years ago
A certain half-reaction has a standard reduction potential E0red = +0.13V . An engineer proposes using this half-reaction at the
Ivan

Answer:

a. 1.23 V

b. No maximum

Explanation:

Required:

a. Is there a minimum standard reduction potential that the half-reaction used at the cathode of this cell can have?

b. Is there a maximum standard reduction potential that the half-reaction used at the cathode of this cell can have?

The standard cell potential (E°cell) is the difference between the standard reduction potential of the cathode and the standard reduction potential of the anode.

E°cell = E°red, cat - E°red, an

If E°cell must be at least 1.10 V (E°cell > 1.10 V),

E°red, cat - E°red, an > 1.10 V

E°red, cat - 0.13V > 1.10 V

E°red, cat > 1.23 V

The minimum standard reduction potential is 1.23 V while there is no maximum standard reduction potential.

4 0
3 years ago
Please help! Asap! :)
timama [110]

The first one is true.

The second one is false.

4 0
3 years ago
Read 2 more answers
Ca3(PO4)2 + 3H2SO4  3CaSO4 + 2H3PO4.
Dominik [7]
If anything isn’t obvious, don’t hesitate to ask me
Check the attached photo out...

4 0
2 years ago
Other questions:
  • Does melting lose or gain energy
    7·2 answers
  • Blue litmus papaer does not change color in the presence of an acid. true or false
    9·2 answers
  • Suppose a tank contains 100 gallons of a solution of 10 lb of salt dissolved in​ water, which is kept uniform by stirring. Pure
    11·1 answer
  • Atoms tendency is to become stable what does this mean
    5·2 answers
  • Human saliva has a pH of about 6.50. Which term BEST describes this solution?
    10·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • MARK ALL of the objects that can be found in our Solar System
    9·2 answers
  • Chapter 7 Ionic Compounds with transition metals. please help!!! will give brainliest
    14·1 answer
  • The critical mass of fissionable material is the largest mass necessary to sustain a nuclear fission chain reaction. single mass
    12·1 answer
  • What does the term solar power mean?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!