AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
Why are molecules such as valinomycin effective at transporting ions across the membrane?
Valinomycin is effective as transporting ions across the membrane because it is no charged, so it can carry ions.
Why would a drop in temperature to or below the transition temperature limit valinomycin mediated K+ transport across the plasma membrane?
Valinomycin is limited by temperature because its activity is highly sensitive and it depends on a stable and an average temperature.
Explanation:
Valinomycin is effective at transporting ion across the membrane because is an antibiotic that alternates hydroxy and amino acid, ans it helps membranes to be permeable. Valinomycin is a cyclic molecule that helps in ions transportation through membranes. Also, antibiotics have a temperature range of activity, that's why it is sensitive to changes.
<span>I think C. incomplete dominance is the answer to your question
</span>
6CO2 + 6H20 + (energy) → C6H12O6 + 6O2
Carbon dioxide + water + energy from light produces glucose and oxygen.
RNA stands for ribonucleic acid. It's primary function is to make ribosomes, hence the answer is 'a'
