Answer:
2HNO3 +Na2CO3 → CO2 + H2O + 2NaNO3
Answer:
$200.0 is the cost for installing a carpet for a room that measures 12.0 feet by 15.0 feet.
Explanation:
Length of the room = l = 15.0 ft = 
Width of the room = w = 12.0 ft = 
(1 yard = 3 feet)
Area of the room = l × w = 
Cost for installing a carpet for a room = $10 per square yard
Cost for installing a carpet for a room wit area 20.0 square yard :
$200.0 is the cost for installing a carpet for a room that measures 12.0 feet by 15.0 feet.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Renewable resources are resources that can be used repeatedly. Examples are wood, wind power, and solar energy.
Nonrenewable resources are resources that cannot be replaced naturally. Examples are oil, coal, and minerals.
