1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
3 years ago
5

Plant cell organelle

Chemistry
1 answer:
prohojiy [21]3 years ago
5 0

Answer:  The organelles found only in plant cells include- chloroplast, cell wall, plastids, and a large central vacuole. The chloroplasts contain a green pigment chlorophyll that is responsible for the process of photosynthesis.

Explanation:

You might be interested in
Why is water called a universal solvent?
kondor19780726 [428]

Answer: B

Explanation:

Water is called the "universal solvent" because it dissolves more substances than any other liquid.

8 0
3 years ago
Read 2 more answers
Write a conclusion using the CER method. Your conclusion must include the following: - Claim: State your claim. Your claim is th
Karolina [17]
Nobody on here is going to write a entire cer for you
4 0
3 years ago
How do you calculate mass using density and volume?
skad [1K]
Example:

Mass = ?

Density = 25 g/mL

Volume = 5 mL

therefore:

d = m / V

25 = m / 5

m = 25 x 5

m = 125 g

hope this helps!

7 0
3 years ago
When we don't use prefixe ina binary compound​
Karolina [17]

Answer:

Explanation:

Answer will be wrong

5 0
4 years ago
Read 2 more answers
The region outside the nucleus where an electron can be found
Alex Ar [27]
The region where an electron is most likely to be is called an orbital
6 0
3 years ago
Other questions:
  • The building block of silicate minerals is called the _____. A) silicon-oxygen tetrahedron. B) aluminum-oxygen tetrahedron. C) s
    6·2 answers
  • How much heat is needed to raise the temperature of 50.0 g of water from 4.5 ⁰C <br> to 83.0 ⁰C?
    6·1 answer
  • Select the phrase that completes each statement. • Honey is . • Grape juice is • Sand on the beach is . • A mixture of carbon di
    8·1 answer
  • of the metals fe, cd, au and na which will not give up its electrons to silver (ag) in a redox reaction
    15·2 answers
  • Which combination of elements below will bond ionically and in the same ratio as lithium when it bonds to sulfur?
    15·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • 2. Most of the water and other substances dissolved in the plasma returns to circulation during the process of
    6·2 answers
  • Research some ways in which scientists and engineers have harnessed and currently use the energy in fossil fuels to benefit soci
    5·1 answer
  • What part of the atom is involved in chemical reactions?
    15·2 answers
  • Which of the following equations is correctly balanced? UO2(s)+4HF(l)→UF4(s)+H2O(l) NCl3(g)+3H2O(l)→NH3(g)+HClO(aq) 4NH3(g)+3O2(
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!