1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skad [1K]
3 years ago
15

Write and balance the equation for the decomposition of aluminum chloride into its elements. phase symbols are optional.

Chemistry
2 answers:
lora16 [44]3 years ago
7 0
The 3 and 2 to the right of the components are subscriptions.

Setler [38]3 years ago
5 0

Explanation:

A balanced equation is an equation in which number of molecules on both left and right side are the same or equal.

When aluminium chloride decomposes then it gives aluminium and chlorine gas.

The decomposition reaction will be as follows.

        2AlCl_{3} (s) \rightarrow 2Al(s) + 3Cl_{2}(g)

Therefore, we can see that number of molecules on the reactant and product side are same. Hence, this equation is balanced.

You might be interested in
Which of the following displays the correct change in enthalpy and best describes the reaction below? 2CsCl(aq) + Na2SO4(aq) 2Na
Bond [772]
We subtract the enthalpies of the reactants from that of the products:
2\Delta
 H(NaCl)+\Delta H(Cs_2 SO_4)-2\Delta H(CsCl)-\Delta H(Na_2 SO_4) \\ 
=2(-411)+(-1400) -2(-415)-(-1380) \\ = -12 kJ
Since this is < 0, this is an exothermic reaction.

3 0
3 years ago
How lead and iodine compound formed
ale4655 [162]
These are dissolved in water to form colourless solutions, and then mixed together. This mixing leads to a double displacement reaction, essentially resulting in the metals 'swapping' their places in the two compounds, producing lead (II) iodide, and potassium nitrate.
3 0
3 years ago
Tia has a sample of pure gold (Au). She weighed the sample and the result was 62.4 grams. Tia wants to determine the number of a
Marta_Voda [28]
I hope you are able to find your answer through the guidance of this site as I have yet to cover this topic in chemistry: http://scientifictutor.org/1021/chem-how-to-convert-between-grams-and-molecules/
7 0
3 years ago
What are the steps of natural selection?
blagie [28]

Answer:

The five steps involved in the process of natural selection are

Variation • Inheritance • Selection • Time • Adaptation

☆anvipatel77☆

•Expert•

Brainly Community Contributor

5 0
2 years ago
In the chemical reaction below, what Is the product? C+o2 -&gt; Co2
vlada-n [284]

Answer:

CO₂

Explanation:

The product of the reaction is CO₂.

In a chemical reaction, the product is the substance usually found on the right hand side of the expression.

  Reaction equation is given as;

          C  +  O₂  →  CO₂  

In this reaction, C and O₂ are the reactants

  CO₂ is the product of the reaction.

  • This reaction is called a combination reaction in which two species combines to give a product.
6 0
3 years ago
Other questions:
  • After your body breaks down food what are three things that can happen to the atoms from your food
    13·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Each period in the periodic table corresponds to
    15·2 answers
  • If the melted lead got hot enough to vaporize, how much energy would it have taken to vaporize 21
    11·1 answer
  • A4 g sugar cube (Sucrose : C 12 H 22 O 11 ) is dissolved in a 350 ml teacup of 80 C water. What is the percent composition by ma
    11·1 answer
  • Hey please answer this for me thanks.
    9·1 answer
  • .........................helpplsplspls.....................
    7·2 answers
  • Structural formula for alkene with double bond st carbon 2 that shows no trans -cis isomerism C6H12​
    12·1 answer
  • Using your knowledge of properties of matter, choose the correct description: Question 3 options: physical prop. are luster, col
    5·1 answer
  • Why does benzocaine precipitate during neutralization?.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!