Answer:
Here is one way: Add water to the mixture. Only the sugar dissolves. This is a physical change.
Explanation:
The sugar would dissolve in water. You could then pour off the solution and wash the remaining sand with a bit more water. Heat the water to evaporate it from the sugar, and the two are separated.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
Ammonia is limiting reactant
Amount of oxygen left = 0.035 mol
Explanation:
Masa of ammonia = 2.00 g
Mass of oxygen = 4.00 g
Which is limiting reactant = ?
Balance chemical equation:
4NH₃ + 3O₂ → 2N₂ + 6H₂O
Number of moles of ammonia:
Number of moles = mass/molar mass
Number of moles = 2.00 g/ 17 g/mol
Number of moles = 0.12 mol
Number of moles of oxygen:
Number of moles = mass/molar mass
Number of moles = 4.00 g/ 32 g/mol
Number of moles = 0.125 mol
Now we will compare the moles of ammonia and oxygen with water and nitrogen.
NH₃ : N₂
4 : 2
0.12 : 2/4×0.12 = 0.06
NH₃ : H₂O
4 : 6
0.12 : 6/4×0.12 = 0.18
O₂ : N₂
3 : 2
0.125 : 2/3×0.125 = 0.08
O₂ : H₂O
3 : 6
0.125 : 6/3×0.125 = 0.25
The number of moles of water and nitrogen formed by ammonia are less thus ammonia will be limiting reactant.
Amount of oxygen left:
NH₃ : O₂
4 : 3
0.12 : 3/4×0.12= 0.09
Amount of oxygen react = 0.09 mol
Amount of oxygen left = 0.125 - 0.09 = 0.035 mol
Answer:
have stars that might appear to wobble
often have one star that is brighter than the other
Explanation:
A binary star system is a star system made up of mostly two stars that moves round their common fixed center.
The two orbiting stars are gravitationally bonded to one another and they move round each other.
Most binary stars might appear wobble. One of the stars often appears brighter than the other.
