1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
azamat
3 years ago
9

Calculate the molarity and normality of 5.7 g of Ca(OH)2 in 450 mL of solution.

Chemistry
1 answer:
Kisachek [45]3 years ago
7 0
  The  molarity   and  normality  of  5.7 g  of  Ca(OH)2   in  450ml  0f    solution  is  calculated  as  follows

molarity  =  moles/volume in  liters
moles  =mass/molar  mass
=  5.7g/74g/mol  =  0.077moles
molarity =  0.077/450  x1000= 0.17M

Normality =  equivalent  point  x molarity
equivalent  point  of Ca(OH)2  is  2   since  it has  two  Hydrogen  atom

normality  is therefore =  0.17  x2 = 0.34 N
You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Solutions of lead(II) nitrate and potassium iodide were combined in a test tube.
AnnyKZ [126]

Answer:

Explanation: When solutions of potassium iodide and lead nitrate are combined?

The lead nitrate solution contains particles (ions) of lead, and the potassium iodide solution contains particles of iodide. When the solutions mix, the lead particles and iodide particles combine and create two new compounds, a yellow solid called lead iodide and a white solid called potassium nitrate. Chemical Equation Balancer Pb(NO3)2 + KI = KNO3 + PbI2. Potassium iodide and lead(II) nitrate are combined and undergo a double replacement reaction. Potassium iodide reacts with lead(II) nitrate and produces lead(II) iodide and potassium nitrate. Potassium nitrate is water soluble. The reaction is an example of a metathesis reaction, which involves the exchange of ions between the Pb(NO3)2 and KI. The Pb+2 ends up going after the I- resulting in the formation of PbI2, and the K+ ends up combining with the NO3- forming KNO3. NO3- All nitrates are soluble. ... (Many acid phosphates are soluble.)

3 0
3 years ago
suppose the burner under the pan of boiling water is turned to a higher settings. how will this affect the temperature of the wa
andrezito [222]

Answer:

Boiling hot?

Explanation:

5 0
2 years ago
A mixture of 454 kg of applesauce at 10 degrees Celsius is heated in a heat exchanger by adding 121300 kJ. Calculate the outlet
stira [4]

Explanation:

The given data is as follows.

           Mass of apple sauce mixture = 454 kg

           Heat added (Q) = 121300 kJ

 Heat capacity (C_{p}) of apple sauce at 32.8^{o}C = 4.0177 kJ/kg^{o}C

So, Heat given by heat exchanger = heat taken by apple sauce

                            Q = mC_{p} \Delta T

or,                    Q = mC_{p} (T_{f} - T_{i})  

Putting the given values into the above formula as follows.

                     Q = mC_{p} (T_{f} - T_{i})  

              121300 kJ = 454 kg \times 4.0177 kJ/kg^{o}C \times (T_{f} - 10)

                      T_{f} = 76.5^{o}C

Thus, we can conclude that outlet temperature of the apple sauce is 76.5^{o}C.

3 0
3 years ago
Is the following equation balanced? SO3 + 2H2O H2SO4 no yes
postnew [5]

Answer: No

Explanation: It's not balanced because four oxygen atoms in H2SO4,  whereas there are 5 oxygen atoms in the reactants side. Also, there's more hydrogen atoms on the reactants side.

I hope this helps!

7 0
3 years ago
Other questions:
  • Which of the following would represent a single displacement reaction between Potassium Bromide (K^+Br^-) and Iodine (I), which
    12·1 answer
  • Carbon is important to the structure of macromolecules because it has a valence of 4. what does this mean?
    9·1 answer
  • Which of the following statements is correct about the gases which participate in photosynthesis? (5 points)
    8·1 answer
  • Rubbing alcohol is 70.% (m/v) isopropyl alcohol by volume. how many ml of isopropyl alcohol are in a 1 pint (473 ml) container?
    10·2 answers
  • A homogeneous portion of a mixture that is characterized by uniform properties and capable of being separated by mechanical mean
    11·2 answers
  • Complete each of the following nuclear reactions by determining the missing particle, then name that particle("alpha particle" o
    10·1 answer
  • An atom's electrons have a great effect on
    10·2 answers
  • If two charged objects are moved closer to each other, the electric force between them will?
    15·1 answer
  • What information is needed to calculate the average atomic mass of an element?(1 point)
    5·1 answer
  • HAAAAAALP MEEEEEEEEEEE​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!