1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pantera1 [17]
3 years ago
8

How many neutrons are in calcium nitride

Chemistry
1 answer:
xxTIMURxx [149]3 years ago
8 0

Answer:

20

Explanation:

You might be interested in
when Mn2 ions are separated from the mixture, they go through a series of oxidizing and reducing steps. Write the reaction equat
goldfiish [28.3K]

Answer: hello some part of your question is missing below is the missing part

when H₂O and H₂O₂ is added to Mn(OH)₂(s) and put in water bath to dissolve

answer : attached below

Explanation:

When Mn²⁺ ions are separated from the mixture, attached below are the requires reaction equations that shows the process of separation.

Mn²⁺ ions are separated to the right of the reaction  equations

8 0
3 years ago
What is biopolymer ?​
Greeley [361]

Answer:

Biopolymers are natural polymers produced by the cells of living organisms. Biopolymers consist of monomeric units that are covalently bonded to form larger molecules. There are three main classes of biopolymers, classified according to the monomers used and the structure of the biopolymer formed: polynucleotides, polypeptides, and polysaccharides.

Explanation:

5 0
3 years ago
Read 2 more answers
Describe what occurs to the particles of a substance when the substance melts. Explain why this occurs.
GuDViN [60]

Explanation:

As a substance melts, and goes from a solid to a liquid state, the kinetic energy of the molecules increases, and the molecules move faster, and they separate further and further away from each other. The intermolecluar forces holding the molecules together become weaker

7 0
2 years ago
3 points
vfiekz [6]

Answer:

density=6.74g/ml

:320g÷47.5ml

d=6.74g/ml

thank you

<em><u>I </u></em><em><u>hope</u></em><em><u> </u></em><em><u>this </u></em><em><u>is </u></em><em><u>helpful</u></em>

8 0
2 years ago
I<br> 3. In words, explain what occurs in terms of electrons when<br> beryllium reacts with oxygen
Drupady [299]

Explanation:

On the whole, the metals burn in oxygen to form a simple metal oxide. Beryllium is reluctant to burn unless it is in the form of dust or powder. Beryllium has a very strong (but very thin) layer of beryllium oxide on its surface, and this prevents any new oxygen getting at the underlying beryllium to react with it

8 0
3 years ago
Other questions:
  • What would be the scenario of negative acceleration
    11·2 answers
  • The most stable conformation of trans-1-tert-butyl-2-methylcyclohexane is the one in which:
    7·1 answer
  • 1. This is a physical combination of one substance dissolved in another.
    8·2 answers
  • What would be a simple way to block erosion
    11·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which gases are responsible for global warming?
    8·1 answer
  • PLS HELP
    12·2 answers
  • What is polar and unpolar bonds?
    12·1 answer
  • Ok so i haven't been on this in a long time ig and so i don't know i just need help on this so i can play my fav video game oof
    7·1 answer
  • What is one benefit that nuclear power plants currently provide for our environment?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!