1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vfiekz [6]
3 years ago
8

For the reaction A+B↽−−⇀C+D, assume that the standard change in free energy has a positive value. Changing the conditions of the

reaction can alter the value of the change in free energy (ΔG). Classify the conditions as to whether each would decrease the value of ΔG, increase the value of ΔG, or not change the value of ΔG for the reaction. For each change, assume that the other variables are kept constant.
A. Adding a catalystb.
B. Increasing [C] and [D]
C. Coupling with ATP hydrolysis
D. Increasing [A] and [B]
Chemistry
1 answer:
77julia77 [94]3 years ago
7 0

Explanation:

a. Adding a catalyst

no effect .( Catalyst can only change the activation energy but not the free energy).

b. increasing [C] and [D]

Increase the free energy .

c. Coupling with ATP hydrolysis

decrease the free energy value .

d.Increasing [A] and [B]

decrease the free energy.

You might be interested in
Which statements describe Rutherford’s model of the atom? Select three options.
AnnZ [28]

Answer:

Well, I cannot see the options but if I were you I would choose the one closest to this. Rutherford's model shows that an atom is mostly empty space, with electrons orbiting a fixed, positively charged nucleus in set, predictable paths.

Explanation:

Again I cannot see the options but here is what I would guess. Hope this helped and have a great day! :-)

6 0
3 years ago
Read 2 more answers
A transverse wave is traveling from north to south. Which statement could be true for the motion of the wave particles in the me
Agata [3.3K]
<span>C. Their direction of motion is south and north. </span>
7 0
3 years ago
Calculate the number of grams of solute in 814.2mL of 0.227 M calcium acetate
kiruha [24]

Answer:

Mass = 29.23 g

Explanation:

Given data:

Volume of solution = 814.2 mL 814.2/1000 = 0.8142 L)

Molarity of solution = 0.227 M

Mass of solute in gram = ?

Solution:

Molarity = number of moles / volume in L

By putting values,

0.227 M = number of moles / 0.8142 L

Number of moles = 0.227 M × 0.8142 L

Number of moles = 0.184 mol

Mass in gram:

Mass = number of moles × molar mass

Molar mass of calcium acetate = 158.17 g/mol

Mass = 0.184 mol × 158.17 g/mol

Mass = 29.23 g

6 0
3 years ago
What is a scientific law?
Stells [14]

Answer:

Scientific laws or laws of science are statements, based on repeated experiments or observations, that describe or predict a range of natural phenomena. The term law has diverse usage in many cases across all fields of natural science.

Explanation:

I hope this helps

3 0
3 years ago
Read 2 more answers
There are islands in the ocean that are growing larger. The Hawaiian Islands are good examples of this. The reason that the isla
Inessa [10]
My guess would be "B) they were produced by volcanoes" because hawaii has a bunch of volcanoes and volcanoes can produce extra land. While the other answers wouldn't make sense. Definitely B.
5 0
3 years ago
Other questions:
  • What is the mass percent of a solution of 7.6 grams sucrose in 83.4 grams of water
    9·1 answer
  • What is the boiling point of a solution that contains 3 moles of KBr in 2000 g of water? (Kb = 0.512 C/m)
    6·1 answer
  • What is the formula for this ionic compound and tha name ?
    15·1 answer
  • Help me!!!<br>will give the brainliest!!<br>plz answer correctly<br>Urgent!!!​
    11·2 answers
  • Which of the following choices is an example of a nonvascular plant?
    9·1 answer
  • An object was measured by a worker as 35.6cm long, however, the manufacturer specifications list the length of the object at 35.
    12·1 answer
  • Which element is oxidized in the following reaction: 2FeCl₂ + Cl₂→2FeCl₃ if Fe goes from + 2 to +3 and Cl goes from 0 to −2?
    5·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Present in a state where it molecules are far apart during a change of state it's molecules slow down which change of state has
    15·1 answer
  • ¿POR QUÉ EL AGUA Y EL ACEITE NO SE MEZCLAN?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!