1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enyata [817]
3 years ago
15

A 100.0 mL solution containing 0.864 g of maleic acid (MW=116.072 g/mol) is titrated with 0.276 M KOH. Calculate the pH of the s

olution after the addition of 54.0 mL of the KOH solution. Maleic acid has pKa values of 1.92 and 6.27. pH= At this pH, calculate the concentration of each form of maleic acid in the solution at equilibrium. The three forms of maleic acid are abbreviated as H2M, HM−, and M2−, which represent the fully protonated, intermediate, and fully deprotonated forms, respectively. [M2−]= M [HM−]= M [H2M]=
Chemistry
1 answer:
Lilit [14]3 years ago
3 0

Answer:

pH = 1.32

Explanation:

                 H₂M + KOH ------------------------ HM⁻ + H₂O + K⁺

This problem involves a weak diprotic acid which we can solve by realizing they amount  to buffer solutions.  In the first  deprotonation if all the acid is not consumed we will have an equilibrium of a wak acid and its weak conjugate base. Lets see:

So first calculate the moles reacted and produced:

n H₂M = 0.864 g/mol x 1 mol/ 116.072 g  =  0.074 mol H₂M

54 mL x  1L / 1000 mL x 0. 0.276 moles/L = 0.015 mol KOH

it is clear that the maleic acid will not be completely consumed, hence treat it as an equilibrium problem of a buffer solution.

moles H₂M left = 0.074 - 0.015 = 0.059

moles HM⁻ produced = 0.015

Using the Henderson - Hasselbach equation to solve for pH:

ph = pKₐ + log ( HM⁻/ HA) = 1.92 + log ( 0.015 / 0.059) = 1.325

Notes: In the HH equation we used the moles of the species since the volume is the same and they will cancel out in the quotient.

For polyprotic acids the second or third deprotonation contribution to the pH when there is still unreacted acid ( Maleic in this case) unreacted.

           

You might be interested in
What information does a molecular formula give?
Leokris [45]

Answer:

A. The actual number of atoms in a molecule

Explanation:

Molecular formula is simply defined as a type of chemical formula that describes the type and number of atoms present in a single molecule of a compound.

Looking at the options, the correct answer is option A.

5 0
3 years ago
Read 2 more answers
Question 2
san4es73 [151]

Explanation:

its hard to explain unless we know what the question fully asks..

4 0
2 years ago
PLEASE HELP ME!!
blagie [28]

1, When temperature is increased the volume will also increase. this is because the particles will gain kinetic energy and bombard the walls of the container of the gas at a higher frequency, therefore, for the pressure to remain constant as per Charles' law, the volume will have to increase so that the rate of bombardment remains constant. This is explained by the Charles law which states that the volume of a gas is directly proportional to the absolute temperature provided pressure remains constant.

2. When temperature is Decreased the volume will also Decrease. this is because the particles will loose kinetic energy and bombard the walls of the container of the gas less frequently, therefore, for the pressure to remain constant as per Charles' law, the volume will have to reduce so that the rate of bombardment remains constant. This is explained by the Charles law which states that the volume of a gas is directly proportional to the absolute temperature provided pressure remains constant.

3. When temperature is increased the pressure will increase. This is because the gas particles gain kinetic energy and bombard the walls of the container more frequently. this is according to Pressure law which states that for a constant volume of a gas the pressure is directly proportional to absolute temperature

4. When temperature is decreased, pressure will decrease, This is because the gas particles lose kinetic energy and bombard the walls of the container less frequently. this is according to Pressure law which states that for a constant volume of a gas the pressure is directly proportional to absolute temperature

5. When particles are added, pressure will increase. This is because the bombardment per unit area also increases. Boyles law explains this, that at fixed temperature the volume of a gas is inversely proportional to the pressure.

6. When particles are removed, the pressure will decrease. This is because the bombardment per unit area also decreases. Boyle's law explains this, that at fixed temperature the volume of a gas is inversely proportional to the pressure.

7 0
3 years ago
Which of the following is an acceptable IUPAC name?(A) 3,6-dimethylheptane (B) 2-ethyl-3-methylheptane (C) 5-methyl-3-ethylhepta
bearhunter [10]

Answer:

D) 4-ethyl-4-methylheptane

Explanation:

The rules for naming of alkanes with substituents.

1. The carbon chain with the maximum number of carbon atoms must be selected as a parent chain.

2.Numbering should be done in such a way that each substituent gets the least number.

3. Substituents whose name comes before the another substituents's name in the English alphabet is written first.

4. Substituents are written first with their location in the chain and the name of the parent chain is done. Numbers are separated from numbers by comma and numbers are separated from letters by using hyphen.

Considering (a) 3,6-dimethylheptane

<u>Violation of Rule - 2 mentioned above</u>

The numbering of the parent chain is not done in a right way. Numbering must be done such that each substituent gets the least number. So, The correct name is 2,5-dimethylheptane

Considering (b) 2-ethyl-3-methylheptane

<u>Violation of Rule - 1 mentioned above.</u>

The carbon chain with the maximum number of carbon atoms must be selected as a parent chain. The parent chain selected is of 7 carbon atoms but the parent chain is of 8 carbon atoms. So, The correct name is 3,4-dimethyloctane

Considering (c) 5-methyl-3-ethylheptane

<u>Violation of Rule - 3 mentioned above.</u>

'e' comes before 'm' . So, ethyl- is written first than methyl- . So, The correct name is 3,6-dimethyloctane

Considering (d) 4-ethyl-4-methylheptane

<u>This is a IUPAC name and following all the rules mentioned above.</u>

3 0
3 years ago
What are all 18 groups of the periodic table?
lukranit [14]

Go to this website for any Periodic table help. It helped me so much!

https://www.chemicool.com/


6 0
3 years ago
Other questions:
  • Which is it hard to seperate one.<br> isotope from<br> from another.
    12·1 answer
  • 5.05 g<br> Express your answer as an integer.
    5·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • 1 ______ energy is stored in the zinc rod, the copper rod, and their solution
    12·1 answer
  • “Zn” is a... <br><br><br> Chemicals Formula <br><br><br> Symbol <br><br><br> Name
    5·1 answer
  • `One way to make ammonia is to synthesize it directly from elemental nitrogen and hydrogen (though this isn't that easy). The eq
    12·2 answers
  • 1. Part 2: Single-Displacement Reactions: For each of the four single-displacement reactions, write a balanced equation. Assume
    10·1 answer
  • Arrange the following compounds in order of increasing acidity, and explain the reasons for your choice of order. Enter your ans
    8·1 answer
  • A diagram of the areas surrounding the Gulf of Mexico is provided. A hurricane that comes in from the Gulf of Mexico will most l
    7·1 answer
  • Which of the following is the best way to
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!