Because around the world we dont all speak the same so by using these names we know we are talking about the same animals.
Answer:
In addition to dinitrogen, other inorganic and organic forms exist in the soil as well. It makes up 78 percent of the atmosphere but <u>cannot be used by plants. </u>It is taken into the soil by bacteria, some algae, lightning, and other means.
Explanation:
D) plants absorb water and use the water for photosynthesis
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
