1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nitella [24]
3 years ago
8

write a balanced chemical equation for solid copper reacting with aqueous silver nitrate to produce aqueous copper (II) nitrate

and solid silver
Chemistry
1 answer:
sashaice [31]3 years ago
7 0
Make sure have same amounts of species on both sides
Cu (s) + 2 AgNO3 (aq) -> Cu(NO3)2 (aq) + 2 Ag (s)
You might be interested in
Which of the example most complete description an objects motion?
Rashid [163]
<span>c] The golfer sent the golf ball flying toward the cup to score a hole in one.</span>
4 0
3 years ago
A chemistry teacher is able to grade chemistry labs at a rate of 5 labs for every 3 minutes. They need to grade 165 labs how man
PIT_PIT [208]

Answer:

1.65hr

Explanation:

Given parameters:

Number of labs  = 5 labs

 Time taken  = 3 minutes

Unknown:

Time taken in hours to grade 165 labs  = ?

Solution:

Let us find the rate of the teacher;

  Rate  = \frac{number of labs}{time}  

  Insert the parameters and solve;

   Rate  = \frac{5}{3}   = 1.67labs/min

Now;

   Time to grade 165 labs  = \frac{number of labs}{rate}  

   Time to grade 165 labs  = \frac{165}{1.67}   = 98.8min

  Since;

               60min = 1hr

               98.8min  = \frac{98.8}{60}   = 1.65hr

3 0
3 years ago
Calculate the amount of solute needed for 1000 ml of 15% sodium thiosulfate
maksim [4K]
15% =  15 grams of solute in 100 mL solution

15 g --------------- 100 mL
?? ------------------ 1000 mL

1000 x 15 / 100 = 

15000 / 100 => 150 g of solute

hope this helps!
7 0
3 years ago
Diagram of mass spectroscopy​
ra1l [238]

Explanation:

“The basic principle of mass spectrometry (MS) is to generate ions from either inorganic or organic compounds by any suitable method, to separate these ions by their mass-to-charge ratio (m/z) and to detect them qualitatively and quantitatively by their respective m/z and abundance

4 0
2 years ago
Which statement is true about a polyatomic ion?
andrew11 [14]

Answer:

The correct answer is that it is made of atoms that are covalently bonded together.

Explanation:

Hope this helped Mark BRAINLEST!!!

5 0
2 years ago
Other questions:
  • What conclusion was a direct result of the gold foil experiment
    11·1 answer
  • What larger class does DNA belong to?
    7·2 answers
  • Explain what a glycosolation reaction is
    10·1 answer
  • What is the wavelength of a wave with a<br>velocity of 50 m/s and a frequency of 5 Hz?​
    14·1 answer
  • People mine zinc metal for use as an anticorrosive, skin protectant, and in electrical components. Zinc mining involves using ch
    15·2 answers
  • Which of these is a learned behavior of a dog?
    11·2 answers
  • Atoms and ions are held together by..
    5·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Explain what it means for an atorn to be neutral.
    14·1 answer
  • Calculate the mass of Cr(ClO2)2 that contains 5.57 × 10<br> ^22 chlorine atoms.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!