1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
avanturin [10]
3 years ago
6

How many milligrams of sugar are in a teaspoon of sugar

Chemistry
1 answer:
grigory [225]3 years ago
6 0

Answer 2325 milligrams.

Explanation:The unit is abbreviated as tsp. Convert Milligrams (mg) to Teaspoons (tsp): 1 mg is approximately equal to 0.0002 tsps. One milligram is a relatively small quantity of table sugar A mere one-teaspoon of granulated sugar contains some 2325 milligrams. Yay wiki

You might be interested in
Why are there 6 electrons in O2
o-na [289]

Two oxygen atoms in a oxygen molecule share two electrons. Oxygen atoms only have 6 valence electrons. They want 8 electrons so they need to steal two or share two.

5 0
4 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
In which liquid is hydrogen bonding strongest? 1. hf(l) 2. h2(l) 3. ch4(l) 4. nh3(l)?
olya-2409 [2.1K]
For chapter 4 is the strongest because he is 100 and bonding strongest is which liquid is hydrogen bonding strong it so that means it
5 0
3 years ago
Which of the following electron configurations are written incorrectly?
Lynna [10]

Answer:

The electronic configuration that are incorrectly written is 1s²2s³2p⁶, 4s²3d¹⁰4p⁷, 3s¹ and 2s²2p⁴.

Explanation:

The electronic configuration of the elements corresponds to how all the electrons of an element are arranged in energy levels and sub-levels.

There are 7 energy levels —from 1 to 7— whose sublevels are described as s, p, d and f.

All electronic configurations begin with the term "1s" —corresponding to the sublevel s of level 1— so 4s²3d¹⁰4p⁷, 3s¹ and 2s²2p⁴ are incorrectly written. In addition, 4s²3d¹⁰4p⁷ is written incorrectly because is impossible to jump from the sublevel "s" to the sublevel "d" —which is found from level 3 and up— without passing through the sublevel "p".

In the case of 1s²2s³2p⁶, the wrong thing is that the sublevel "s" can only hold two electrons, not three.

The other options are correctly written.

3 0
3 years ago
Copper metal has a specific heat of 0.385 J/goC. Calculate the amount of heat required to raise the temperature of 22.8 g of Cu
Liula [17]

Answer is equal to 7.51 kJ

Q=mc(delta)T

4 0
2 years ago
Other questions:
  • Carbonic acid, H2CO3, has two acidic hydrogens. A solution containing an unknown concentration of carbonic acid is titrated with
    13·1 answer
  • A double-replacement reaction takes place when aqueous k2so4 reacts with aqueous pb(no3)2. you would expect the products of this
    9·2 answers
  • How does matter move and change through photosynthesis??
    10·1 answer
  • compute the mass of CaSO4 that can be prepared by the reaction of 3.2900g of H2SO4 with 3.1660g of CaCO3
    11·2 answers
  • Which of the following is a correct formula unit of an ionic compound?
    11·2 answers
  • Because many substances dissolve in water, it is considered a universal solvent. Which property of water explains this phenomeno
    5·2 answers
  • Name the following alkanes:<br> CH, - CH, -CH, - CH,<br> 1
    10·1 answer
  • The density of acetonitrile (CH3CN) is 0.786 g/mL and the density of methanol (CH3OH) is 0.791 g/mL. A solution is made by disso
    10·1 answer
  • Which of the following measures of concentration changes with temperature?
    11·1 answer
  • Explain how chemical spills on a person are handled when they are spilled :
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!