1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
uysha [10]
3 years ago
6

What is the frequency of a photon having an energy of 4.91 × 10–17 ? (c = 3.00 × 108 m/s, h = 6.63 × 10–34 J · s)​

Chemistry
1 answer:
AlexFokin [52]3 years ago
4 0

Answer:

The frequency of the photon is 7.41*10¹⁶ Hz

Explanation:

Planck states that light is made up of photons, whose energy is directly proportional to the frequency of radiation, according to a constant of proportionality, h, which is called Planck's constant. This is expressed by:

E = h*v

where E is the energy, h the Planck constant (whose value is 6.63*10⁻³⁴ J.s) and v the frequency (Hz or s⁻¹).

So the frequency will be:

v=\frac{E}{h}

Being E= 4.91*10⁻¹⁷ J and replacing:

v=\frac{4.91*10^{-17} J}{6.63*10^{-34} J.s}

You can get:

v= 7.41*10¹⁶ \frac{1}{s}= 7.41*10¹⁶ Hz

<u><em>The frequency of the photon is 7.41*10¹⁶ Hz</em></u>

<u><em></em></u>

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Balance the following equation:<br>sodium + Sodium Nitrate = Sodium Oxide + Nitrogen
-Dominant- [34]
Na + NaNO3 = Na2O + N2

4 Na + 2 NaNO3 = 6 Na2O + N2

6 Na on each side
2 N on each side
6 O on each side
6 0
3 years ago
Calculate the grams of solute in each of the following solution: 278 mL of 0.038 M Fe2(SO4)3
Goryan [66]

Answer:  4.22 grams of solute is there in 278 ml of 0.038 M Fe_2(SO_4)_3

Explanation:

Molarity of a solution is defined as the number of moles of solute dissolved per liter of the solution.

Molarity=\frac{n}{V_s}

where,

n = moles of solute

V_s = volume of solution in L

Now put all the given values in the formula of molality, we get

0.038M=\frac{n}{0.278L}

n=0.0105mol  

mass of  Fe_2(SO_4)_3 = moles\times {\text {Molar Mass}}=0.0105\times 399.88g/mol=4.22g

Thus 4.22 grams of solute is there in 278 ml of 0.038 M Fe_2(SO_4)_3

3 0
3 years ago
A mole of any atom or molecule has the same number of?
GarryVolchara [31]
The answer to this question is particles yes girl work slay that chem
6 0
3 years ago
Read 2 more answers
Which pair of atoms has the highest electronegativity difference?
Tems11 [23]
The answer its O-H.........
7 0
3 years ago
Read 2 more answers
Other questions:
  • How calculate how many milliliters of glycerin (specific gravity=1.26) will have a mass of 0.75 lbs?
    11·1 answer
  • Which of the following compounds will experience hydrogen bonding? (2 points) NH3 HBr C2H4 H2SO4
    7·2 answers
  • A 1.000 g sample of nitrogen combined with a 0.0720 g sample of hydrogen to form N2H2. What compound is formed if 1.000 g of nit
    14·1 answer
  • 1) express 23kg in miligrams
    6·1 answer
  • In the reaction between lead(II) nitrate and sodium chloride, what, if any, are the spectator ions
    7·1 answer
  • - The subatomic particle possessing the largest
    7·1 answer
  • In a reaction where A + B AB, what does an equilibrium position of A= 14%, B = 14%, and AB= 72% indicate about the reaction?
    9·2 answers
  • What is it that lives if it is fed, and dies if you give it a drink
    13·2 answers
  • DONT GUESS OR YOUR ANSWER GETS REPORTED!!Students who like information presented to them in a sequential order likely think with
    5·1 answer
  • How many grams are present in 0.26 moles of methane 
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!