1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergiy2304 [10]
4 years ago
11

Hydrogen and oxygen react under a specific set of conditions to produce water according to the equation:

Chemistry
1 answer:
Nata [24]4 years ago
5 0

Answer:

1. The amount required of H₂ = 11.0 g.

2. The amount required of O₂ = 88.0 g.

Explanation:

  • The balanced equation for the mentioned reaction is:

<em>2H₂(g) + O₂(g) → 2H₂O,</em>

It is clear that 2.0 moles of H₂ react with 1.0 mole of O₂ to produce 2.0 moles of H₂O.

<em>Q1: How much hydrogen would be required to produce 5.5 mol of water? </em>

<u><em>Using cross multiplication:</em></u>

2.0 mol of H₂ produce → 2.0 mol of H₂O, from stichiometry.

??? mol of H₂ produce → 5.5 mol of H₂O.

∴ the no. of moles of H₂ needed to produce 5.5 mol of water = (2.0 mol)(5.5 mol)/(2.0 mol) = 5.5 mol.

  • Now, we can get the mass of H₂ needed to to produce 5.5 mol of water:

mass of H₂ = (no. of moles)(molar mass) = (5.5 mol)(2.0 g/mol) = 11.0 g.

<em>Q2: How much oxygen would be required?</em>

<u><em>Using cross multiplication:</em></u>

1.0 mol of O₂ produce → 2.0 mol of H₂O, from stichiometry.

??? mol of O₂ produce → 5.5 mol of H₂O.

∴ the no. of moles of O₂ needed to produce 5.5 mol of water = (1.0 mol)(5.5 mol)/(2.0 mol) = 2.75 mol.

  • Now, we can get the mass of O₂ needed to to produce 5.5 mol of water:

mass of O₂ = (no. of moles)(molar mass) = (2.75 mol)(32.0 g/mol) = 88.0 g.

You might be interested in
4. The vet instructed Manuel to give his
djverab [1.8K]

Answer:

=60 milligrams

Explanation:

12 x 5

=60 milligrams

Have a nice day!!!!!!! :-)

<u>KA</u>

3 0
3 years ago
Pl help me, i need a good grade on this.
Blizzard [7]
1. Option A. Temperature and Salinity
2. Option D. (I think)
3. Option D.
Hope your test goes well!
8 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
4 years ago
PLEASE HELP!!!!!!!!! 20 points! Which would be best categorized as heat transfer by convection? Usuing a heat blanket to get war
Ghella [55]
I'd say the correct answer is: Noodles rising and falling apart in boiling water.
3 0
4 years ago
Read 2 more answers
2 Ag20 →4 Ag + O2 what reaction is this​
Schach [20]

Answer:

Decomposition

Explanation:

hope it helps you

6 0
3 years ago
Other questions:
  • A gas occupies a volume of 2.4 L at 14.1 kPa. What volume will the gas occupy at 84.6 kPa?
    11·1 answer
  • The limiting reactant is the chemical substance that determines the amount of product(s) that can ultimately be formed in a reac
    9·1 answer
  • A known number of moles of gas is placed in the flexible container below
    15·2 answers
  • What are substance made of
    14·1 answer
  • Which of the following is an acid-base neutralization reaction?
    7·1 answer
  • Is the specimen classified as living or non-living? Use three pieces of evidence and reasoning to justify your answer. Provide 3
    12·1 answer
  • What is the mass of 2.1 moles of Ca(OH)2?
    5·2 answers
  • A female spinach plant with flat (Ff) leaves is crossed with (pollination and fertilization occur) a male spinach plant with cri
    9·1 answer
  • How many grams of sodium carbonate are present after the reaction is complete?
    10·1 answer
  • A sample of gas occupies a volume of 72.0 mL . As it expands, it does 141.2 J of work on its surroundings at a constant pressure
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!