1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jet001 [13]
3 years ago
14

What is a chocking smell​

Chemistry
1 answer:
Goshia [24]3 years ago
7 0

Answer:

A horrible, nasty smell.

Explanation:

A choking smell is a nasty, horrible smell. Hope this helps!

You might be interested in
What happens when the pressure of a gas is decreased?
Serggg [28]

Answer:

The combined gas law states that the pressure of a gas is inversely related to the volume and directly related to the temperature. If temperature is held constant, the equation is reduced to Boyle's law. Therefore, if you decrease the pressure of a fixed amount of gas, its volume will increase.

Explanation:

3 0
3 years ago
Explain why vegetables last longer in a fridge.
jeka57 [31]

It has to do with the releasing of ethylene, which speeds up the ripening process  

6 0
3 years ago
Read 2 more answers
Please help me I will give you the brain thing and extra points. image below part
jekas [21]
D is the correct answer... if u need in depth let me know
3 0
3 years ago
Read 2 more answers
The electron configuration of an element is 1s22s22p4.
MissTica

The likely thing which happens when two atoms of this element move toward each other is covalent bonding.

<h3>What is Covalent bonding?</h3>

This involves the atoms of element sharing electrons in order to achieve a stable octet configuration.

The element is oxygen which has an atomic number of 8 and needs two electrons to complete its outermost shell which results in the formation of two covalent bonds.

Read more about Covalent bonding here brainly.com/question/3447218

#SPJ1

3 0
2 years ago
The information below is a description of a substance:
skelet666 [1.2K]

Answer:

A chemical change

Explanation:

7 0
3 years ago
Other questions:
  • Which family on the periodic table has a filled outer energy level?
    8·1 answer
  • In the 1700s, Isaac Newton determined that the force of gravity between two objects depends on the mass of the objects and dista
    12·2 answers
  • Which elements have 8 valence electrons?
    8·2 answers
  • HELP PRETTY PLEASE QUICKLY!!! AND ILL GIVE YOU BRAINLIEST
    14·1 answer
  • Which statement is true about the ionic size of the elements in a group as one moves from top to bottom in that group?
    9·2 answers
  • PLS HELPPP ASAP
    11·1 answer
  • How do you account for the formation of ethane during chlorination of methane​
    8·2 answers
  • How many atoms are in 15.6 grams of silicon?
    9·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • If 12.2 kg of Al2O3(s), 57.4 kg of NaOH(l), and 57.4 kg of HF(g) react completely, how many kilograms of cryolite will be produc
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!