I think A but if it’s wrong I’m sorry ❤️
Because the catalyst is not really part of the reaction. it is something that speed up a reaction by lowering the energy need for the reaction to take place. however, in the end the catalyst is brought back to its initial state. that's why it is long lasting
Answer:
Mg S2 O3
Explanation:
.691 g of Mg is .284 mole
1.84 g of S is .5739 mole
1.365 g of O is .8531 mole you can see the ratio is ~ 1 :2 :3
Mg S2 O3
I can’t see the picture for some reason but if I were to guess, I would say Pangea.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
