1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alekssr [168]
3 years ago
9

The mass numbers for two isotopes are unequal because they have different numbers of

Chemistry
2 answers:
Savatey [412]3 years ago
8 0

<u>Answer:</u> It is so because they have different number of neutrons.

<u>Explanation:</u>

Isotopes are defined as the chemical species which have same number of protons but differ in the number of neutrons.

They have same atomic number but different atomic mass.

<u>For Example:</u>  _6^{12}\textrm{C},_6^{13}\textrm{C}\text{ and }_6^{14}\textrm{C} are the three isotopes of carbon.

The number of protons in all the three isotopes is same which is 6 and the number of neutrons in the three isotopes are 6, 7 and 8 respectively.

Hence, it is so because they have different number of neutrons.

SSSSS [86.1K]3 years ago
5 0
The mass numbers for two isotopes are unequal because they have different numbers of NEUTRONS.

You might be interested in
 what is 19.8-17.1
Ostrovityanka [42]

Answer: it should be 2.8

Explanation:

7 0
3 years ago
Read 2 more answers
A sample of phosphonitrilic bromide, PNBr2, contains 2.01 mol of the compound. Determine the amount (in mol) of each element pre
nordsb [41]

Answer:

2.01 moles of P → 1.21×10²⁴ atoms

2.01 moles of N → 1.21×10²⁴ atoms

4.02 moles of Br → 2.42×10²⁴ atoms

Explanation:

We begin from this relation:

1 mol of PNBr₂ has 1 mol of P, 1 mol of N and 2 moles of Br

Then 2.01 moles of PNBr₂ will have:

2.01 moles of P

2.01 moles of N

4.02 moles of Br

To determine the number of atoms, we use the relation:

1 mol has NA (6.02×10²³) atoms

Then: 2.01 moles of P will have (2.01  . NA) = 1.21×10²⁴ atoms

2.01 moles of N (2.01  . NA) = 1.21×10²⁴ atoms

4.02 moles of Br (4.02 . NA) = 2.42×10²⁴ atoms

6 0
3 years ago
Read 2 more answers
Which term describes the following group of planets: Jupiter, Saturn, Uranus, and<br> Neptune?
vesna_86 [32]

Answer:

Gas giants.

Explanation:

Jupiter, Saturn, Uranus, and Neptune are the gas giants of our solar system.

4 0
3 years ago
4.1 shows a plant cell. g For Examiner's Use n. C D Fig. 4.1 (i) Name the type of plant cell shown in Fig. 4.1. [1]​
Vinil7 [7]

Answer:

palisade cell due to presence of chloroplasts

7 0
2 years ago
A 6.0 M HCl solution is available. What volume is needed to make 6.00 L of 1.00 M<br> solution?
Ket [755]

Answer:

The volume of the stock solution needed is 1L

Explanation:

Step 1:

Data obtained from the question. This include the following:

Concentration of stock solution (C1) = 6M

Volume of stock solution needed (V1) =?

Concentration of diluted solution (C2) = 1M

Volume of diluted solution (V2) = 6L

Step 2:

Determination of the volume of the stock solution needed.

With the dilution formula C1V1 = C2V2, the volume of the stock solution needed can be obtained as follow:

C1V1 = C2V2

6 x V1 = 1 x 6

Divide both side by 6

V1 = 6/6

V1 = 1L

Therefore, the volume of the stock solution needed is 1L

5 0
3 years ago
Other questions:
  • The complete combustion (reaction with oxygen) of liquid octane (C8H18) a component typical of the hydrocarbons in gasoline, pro
    10·1 answer
  • What are the kingdoms of eukaryotes
    12·1 answer
  • What physical property makes metal pot good for cooking
    7·1 answer
  • A solution of phosphoric acid was made by dissolving 10.0 g of H3PO4 in 100.0 mL of water. The resulting volume was 113 mL. Calc
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The chemical standard for the quantity of a mole is based on which substance? a.hydrogen-1 b.helium-2 c.oxygen-16 d.carbon-12
    5·1 answer
  • Balancing chemical reactions is consistent with which scientific law?
    6·1 answer
  • In the Dumas Method, the volatile sample
    12·1 answer
  • Is this a scientific model? Use complete sentences to explain why or why not
    8·1 answer
  • How are chemical bonds formed?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!