1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna71 [15]
3 years ago
10

Maria and Carla were hiking when Maria tripped, fell, and sprained her ankle. Carla took out the first-aid kit and unwrapped a c

old pack. Carla popped a vial that was inside the cold pack. The two chemicals inside the pack mixed together and the pack began to get icy cold. Carla applied the pack to Maria's ankle. What kind of reaction occurred in the cold pack? What evidence supports your answer? HELP
Chemistry
2 answers:
statuscvo [17]3 years ago
5 0
It is an endothermic reaction, the chemicals (probably water and ammonium nitrate) require more energy to react therefore it absorbs heat from it's surrounding to power the reaction and thus lowering the surrounding temperature. <span />
mash [69]3 years ago
4 0

Answer:

It is a chemical change because heat energy is absorbed and the pack gets colder

Explanation:

I G0T IT RIGHT 0N USATEST PREP

You might be interested in
I NEED HELP ASAP!!!!!!!!!!!<br> WITHIN THE HOUR<br> Thanks
Alex17521 [72]
Its D because

Li = 6
Be =9
C= 12
O=15
6 0
2 years ago
Read 2 more answers
How much heat energy is needed to raise the temperature of 59.7g of cadmium from 25°C to 100°C? The specific heat of cadmium is
labwork [276]
     Using the Fundamental Equation of Calorimetry, we have:

Q=mc\Delta T \\ Q=59.7.0.231.(100-25) \\ \boxed {Q=1034.3025J}      

If you notice any mistake with my english, please know me, because I am not native.
7 0
3 years ago
Don’t mind my cats fur :)
denpristay [2]

Answer:

Potassium is an element, with the symbol K

Explanation:

An element is something that cannot be broken down any further, for example, calcium, its Ca.

A compound is when you bond two or more elements. Compounds can be broken down into its original elements, for example, H₂O, it contains two atoms of hydrogen and one atom of oxygen (both hydrogen and oxygen are elements).

8 0
3 years ago
= 25 X 5 = (use the correct number of sig figs)
Anton [14]

Answer:

1.25 *10^2

Explanation:

25*5 = 125

= 1.25 *10^2

5 0
3 years ago
Calculate the number of ATPs generated by the complete metabolic oxidation of tripalmitin (tripalmitoylglycerol). Hydrolysis of
trapecia [35]

Answer:

Explanation:

412 ATP's will be generated from the complete metabolic oxidation of tripalmitin (tripalmitoylglycerol)

130 ATP from the oxidation of palmitate

22 ATP from the oxidation of glycerol

Altogether 130 + 22 = 412 ATP will be produced.

Here in case of tripalmitin (tripalmitoylglycerol), we have 51 carbons.

When 51 carbons can produce 412 ATPs

Then 1 carbon will produce how many ATPs = 412 ATPs/ 51 carbon= 8.1 ATPs.

This shows that ATP yield per carbon often oxidized will be 8.1 ATPs

Now we will see the ATP yield in the case of glucose.

Glucose is made up of 6 carbon and complete oxidation of glucose will produce 38 ATPs

When 6 carbons can yield 38 ATPs

Then 1 carbon can yield how many ATPs= 38 ATPs/ 6 carbons= 6.33 ATPs.

So, ATP yield per carbon in case of glucose will be 6.33 ATPs

8 0
3 years ago
Other questions:
  • After Frank Palko was sentenced to death by the state of Connecticut, the Supreme Court ruled that
    15·2 answers
  • The following conditions exist in a bacterium and its environment. Environment: 5M NaCl; 1M glucose Inside cell: 3M NaCl; 10M gl
    8·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Determine the oh of a solution that is 0.220 m in hco3
    13·1 answer
  • Which of the following equations is NOT balanced properly? Which of the following equations is NOT balanced properly? Cr2(SO4)3
    10·1 answer
  • Stephanie has been doing research on how petroleum is formed. She says that oxygen must be present while the tiny plants and ani
    10·2 answers
  • CHEM 100Worksheet 6Summer2021Name:____________________(5pts each, 10 pts total) Complete the following multistep synthesis probl
    11·1 answer
  • A synthesis reaction takes place when carbon monoxide (CO) and hydrogen gas (H2) react to form methanol (CH3OH). How many grams
    12·1 answer
  • Predict the ELECTRON and MOLECULAR geometry for a molecule with 5 bonding domains and two lone pairs.
    9·1 answer
  • How many ethnic groups are there in China?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!