1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex Ar [27]
3 years ago
5

2. List elements that need 3 electrons to have a stable outer shell.

Chemistry
1 answer:
stellarik [79]3 years ago
7 0
All of the elements in group five/fifteen. This is because the octet rule is that an element needs eight electrons to become stable. Five plus three is eight. I hope this helped.
You might be interested in
Calculate the percent by volume of a solution that has 75 mL of solute dissolved in 375 mL of solution. Show your work and round
Mandarinka [93]

Answer:

The answer is 20 % V/V

Explanation:

We use this formula for calculate the %V/V:

%V/V= (ml solute/ml solution) x 100= (75ml/375 ml)x 100 = 20 % V/V

<em>The% V / V represents the amount of ml of solute dissolved in 100 ml of solution</em>

7 0
3 years ago
Can any of you guys help me with this. Can y’all give me some facts about nucleus protons netrons and electrons :)
Mumz [18]

Answer:

the nucleus is the center of the atom, made up of protons and neutrons, without the nucleus you'd just have a bunch of electrons floating around; the nucleus is positively charged

protons are the positively charged particles that sit within the nucleus

neutrons are particles of no charge that sit within the nucleus, and because they have no charge, they do not cancel out the positive charge of the protons, making the nucleus positive

electrons are negatively charged particles that float around the nucleus in an area known as the electron cloud, they orbit around the nucleus because they are attracted to the positive charge of the nucleus (caused by the protons), with charges, opposites attract

Explanation:

4 0
3 years ago
How many neutrons does a atom of cobalt have?
OverLord2011 [107]

Did you mean the atomic mass?


4 0
3 years ago
4 NH3 + 7 O2 → 4 NO2 + 6 H2O What is the mole ratio between oxygen and nitrogen dioxide? 7 moles to 6 moles 4 moles to 6 moles 7
Mashutka [201]

Answer:

7:4

Explanation:

O2 : NO2

7 : 4

hope this helps :)

8 0
2 years ago
A gold ring with a mass of 16g was dropped in the snow and its temperature dropped from 35°C to 0°C. How much heat was released
Luda [366]

Answer:

-72.8 joules

Explanation:

just finished the test

4 0
2 years ago
Other questions:
  • a compound is found to have 46.67% nitrogen, 6.70% hydrogen, 19.98% carbon and 26.65% oxygen, what is the empirical formula?
    15·1 answer
  • The solubility of silver chloride can be increased by dissolving it in a solution containing ammonia. agcl (s) ag+ (aq) + cl- (a
    7·2 answers
  • What is the molarity of a 2.0 L sodium hydroxide solution containing 10.0 grams of solute?
    9·1 answer
  • Methane is a colorless, odorless gas. it oxidizes in air and has a boiling point of -161°
    11·2 answers
  • A jet airplane flies from St. Louis, Missouri, to Phoenix, Arizona, in 3 hrs. The distance is
    11·1 answer
  • In the problems below, f(x) = log2x and g(x) = log10x. How are the graphs of f and g similar? Check all that apply. Both have a
    6·2 answers
  • March 10<br> march 3<br> february 16<br> february 22
    14·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • For each of the following substances below, identify the type of bonding between the atoms. Justify your
    5·1 answer
  • Arginine is one of the amino acids; it is used in the biosynthesis of proteins. Analysis revealed that a sample of arginine was
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!