1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Veronika [31]
3 years ago
9

The lava from this volcano has built a mountain. The volcanic mountain is surrounded on all sides by ocean water so it is also

Chemistry
1 answer:
Nataliya [291]3 years ago
4 0

Answer: An island.

"A piece of land surrounded by water"

You might be interested in
Which is a common way for a scientific calculator to show the number below? <br> 8.1 102
Elodia [21]
Answer: 8.1e+2 or 8.1E+2 (in the scientific notation mode), based on that the number given is 8.1 × 10².

Explanation


Scientific calculators use the letter e or E to show the numbers in scientific notation mode.

These are some examples of numbers that require scientific notation and how they are shown.

Number                 Scientific calculator display

6.022 × 10²³           6.022 e+23
5 × 10 -12              5 E -12

So, understanding that your question is about number 8.1 × 10², the scientific calculator could show  8e+2.

Nevertheless, since 8 .1 × 10² is 810, not a long number, if the display is not in scientific notation mode, it could just display just 810,

7 0
3 years ago
In the preparation of a certain alkyl halide, 10 g of sodium bromide (NaBr), 10 mL distilled water (H20), and 9 mL 3-methyl-1-bu
Novosadov [1.4K]

Percentage yield shows the amount of reactants converted into products. The percentage yield of the reaction is 51.7%.

The equation of the reaction is sown in the image attached. The reaction is 1:1 as we can see.

Number of moles of NaBr = 10 g/103 g/mol = 0.097 moles

We can obtain the mass of 3-methyl-1-butanol from its density.

Mass = density × volume

Density of 3-methyl-1-butanol =  0.810 g/mL

Volume of  3-methyl-1-butanol = 9 mL

Mass of 3-methyl-1-butanol = 0.810 g/mL × 9 mL

Mass of 3-methyl-1-butanol = 7.29 g

Number of moles of 3-methyl-1-butanol =  mass/molar mass =  7.29 g/88 g/mol = 0.083 moles

Since the reaction is 1:1 then the limiting reagent is 3-methyl-1-butanol

Mass of product 1-bromo-3-methylbutane = number of moles × molar mass

Molar mass of 1-bromo-3-methylbutane = 151 g/mol

Mass of product 1-bromo-3-methylbutane = 0.083 moles × 151 g/mol

= 12.53 g

Recall that % yield = actual yield/theoretical yield × 100

Actual yield of product = 6.48 g

Theoretical yield = 12.53 g

% yield = 6.48 g/12.53 g × 100

% yield = 51.7%

Learn more: brainly.com/question/5325004

7 0
2 years ago
What kinds of intermolecular forces are present in a mixture of ethanol (ch3ch2oh) and water?
Svetllana [295]
<h3><u>Answer;</u></h3>

Dipole-dipole and hydrogen bonding

<h3><u>Explanation;</u></h3>
  • <em><u>A solution of water and ethanol contains the dipole-dipole forces and hydrogen bonds as the intermolecular forces between molecules.</u></em>
  • <em><u>Hydrogen bonding is a type of interactions between molecules that occurs when a partially negative atom such as oxygen end of one of the molecules is attracted to a partially positive hydrogen end of another molecule.</u></em>
  • <em><u>Dipole-dipole forces</u></em> results from the unsymmetrical distribution of electrons, thus the polarity does not balance, thus resulting to a dipole attraction between molecules.
5 0
3 years ago
Read 2 more answers
Which of the following would NOT diffuse through the plasma membrane by means of simple diffusion?1 oxygen2 glucose3 a steroid h
Mumz [18]

Answer:

Option 2= Glucose

Explanation:

Cell membrane is made up of two phospholipid layers and each contain phosphate head and fatty acid or lipid tails. the head is present between the outer and inner boundaries and tail is present in between. The small non- polar molecules can pass the membrane through simple diffusion. This lipid tail restrict the passage of polar molecules including water soluble substances like glucose. However, transmembranes are present that allow the molecules to inter that are blocked by the tails.

Facilitated diffusion:

it is a type of diffusion in which caries protein without using the cellular energy shuttle the molecules to the cell membrane. Glucose is bind on the carrier protein ,change the shape and transport it from one to another side of membrane. In order to absorb the glucose red blood cells use this kind of diffusion.

Primary active transport:

The cells that are present along small intestine use this type of transport to pump the glucose inside the cell. The primary active transport require energy to transport the glucose inside.

Secondary active transport:

It is another method of transport of glucose into the cell. This method can not use ATP but it is based on concentration gradient of the sodium that provide electro chemical energy for the glucose transport.

5 0
3 years ago
PLZ HELP, GIVING BRAINLIEST!!
andrew-mc [135]

Answer:

Option B. Decreasing the temperature of the solvent

Explanation:

Solubility is mostly enhanced by increasing the temperature of the solvent or solution. This means that am increase in temperature will increase the solubility and decreasing the temperature will decrease the solubility.

5 0
3 years ago
Read 2 more answers
Other questions:
  • If one lightbulb burns out, but the other bulbs remain lit, the circuit must be a
    15·1 answer
  • How are elements arranged in the periodic table? By number or by mass?
    5·2 answers
  • Asalt is best described as a compound that is formed from the reaction between
    15·1 answer
  • PLS HELPPP!!!!
    13·1 answer
  • Only the _______
    14·1 answer
  • When do you identify your variables?
    11·2 answers
  • Can someone please help!
    15·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which of the following choices are the characteristics of life
    13·1 answer
  • 7/3 Lithium. Protons,<br> NEUTRONS &amp; Electrons
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!