1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldi70 [24.7K]
3 years ago
9

Plants need sunlight to make food during the process of:

Chemistry
1 answer:
Andrej [43]3 years ago
6 0

the answer is  photosynthesis

You might be interested in
Can someone please help me
mrs_skeptik [129]
The answer will be D
8 0
3 years ago
This is a test please help
GenaCL600 [577]

Answer:

remaining still during the night.

Explanation:

3 0
2 years ago
All of the halogens, group 17, have seven valence electrons. which of these would represent the oxidation number of the halogens
fomenos
It depends if it occurs naturally it has oxidation number of 0
but when it react with other element it has an oxidation number of -1
6 0
3 years ago
Can somebody plz answer this question only in 1-2 sentences! That would be great thanks so much :)
lbvjy [14]

Pure substances are substances which are homogenous in nature. They either consists of atoms of 1 kind or molecules of 1 kind. Atoms are seen in elements, where as molecules are seen in compounds like Acids, Bases, etc.

They mostly have fixed properties like boiling and melting points and are uniform in nature. :D

4 0
2 years ago
Which of the following has zero acceleration?
belka [17]
'Acceleration' means any change in speed or direction
of motion.

so
 C).  No acceleration.  Straight, at constant speed. 
No change of speed or direction.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Osmium is one of the densest elements known, what is its density if 2.72 g has a volume of 0.121 cm3?
    15·2 answers
  • Which scientist was responsible for discovering the neutron? A. Niels Bohr B. Robert Millikan C. James Chadwick D. Ernest Ruther
    8·2 answers
  • PLEASE HELP!!!!! 20 POINTS IF ANSWERED
    8·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Two volatile liquids A (P A pure= 165 Torr) and B (PB pure= 85.1 Torr) are confined in a piston/cylinder assembly. Initially onl
    15·1 answer
  • Write the volume of the liquid, in milliliters, using the proper number of significant figures.Express your answer with the appr
    6·1 answer
  • What r the uses of bases...!??<br>(follow me plz) ​
    6·1 answer
  • Consider the reaction H2(g) + I2(g) Double headed arrow. 2HI(g). What is the reaction quotient, Q, for this system when [H2] = 0
    12·2 answers
  • Which formula shows a correct representation of the combined gas law?(1 point)
    14·1 answer
  • Calculate the number of grams of ethanol nevessary to prepare 268g of a 9.76m solution of ethanol in water
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!