1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Margarita [4]
4 years ago
7

tell how a voltaic cell works. be sure to mention the various parts of the voltaic cell and what they have to do with how it wor

ks
Chemistry
1 answer:
Lelu [443]4 years ago
4 0
Voltaic cells are  used as a source of electrical power. By their nature, they produce direct current<span>. 
</span>A voltaic cell, or galvanic cell<span> is an </span>electrochemical cell that uses a chemical reaction to produce electrical energy. The cell consists of two metals: one called anode where oxidation (loss of electrons) occurs and the other cathode where reduction (gain of electrons) occurs.The salt bridge connect the anode with the cathode. It is the <span>chamber of electrolytes necessary to complete the circuit in a voltaic cell.
</span><span>The external circuit is used to conduct the flow of electrons between the electrodes of the voltaic cell and  includes a load.</span>
<span>The key to gathering the electron flow is to separate the oxidation and reduction half-reactions, connecting them by a wire, so that the electrons must flow through that wire.</span>
You might be interested in
Please help me with this science ​
allochka39001 [22]

Answer:

Allows diffusion of sub...(true)

its found in both anim...(true)

produces en...(false)

4 0
3 years ago
Determine the pH of a solution of 0.00278 M of HClO4. Report the answer to two digits past the decimal.
aleksandrvk [35]

Answer:

The pH of a solution of 0.00278 M of HClO₄ is 2.56

Explanation:

pH is a measure of acidity or alkalinity that indicates the amount of hydrogen ions present in a solution or substance and is calculated as:

pH= - log [H⁺]= - log [H₃O⁺]

On the other hand , a Strong Acid is that acid that in an aqueous solution dissociates completely. In other words, a strong acid completely dissociates into hydrogen ions and anions in solution.

HClO₄ is a strong acid, so in aqueous solution it will be  totally dissociated. Then, the concentration of protons is equal to the initial concentration of  acid and the pH will be calculated:

pH= - log 0.00278

pH= 2.56

<u><em>The pH of a solution of 0.00278 M of HClO₄ is 2.56</em></u>

8 0
3 years ago
The two most abundant gases in the atmosphere are select one:
Zielflug [23.3K]
I think that the answer is d
4 0
3 years ago
What is the atomic number of the Adam shown 18 protons 22 neutrons
DaniilM [7]
It's 18 (the same as the number of protons:)
4 0
3 years ago
If someone trys to lur u into a car with candy...say NO. and run away
Trava [24]

Answer:

as u should. candy ain't even that tempting >^<

8 0
3 years ago
Read 2 more answers
Other questions:
  • Use the equation editor or "Insert Chemistry - WIRIS editor" to write the balanced molecular chemical equation for the reaction
    7·1 answer
  • A bowling ball has a mass of 10.0kg. If a net force of 35N is applied to the ball, what’s the acceleration?
    7·1 answer
  • Someone pls pls pls help me with this question.
    15·1 answer
  • Explain why ply(ethene) can become a pollutant? ​
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Classify the following compounds as ionic or covalent: a. MgCl2 b. Na2S c. H2O d. H2S
    10·2 answers
  • The best material to be used in making cooking pots handles is made of: a. Polypropylene b. Bakelite c. Rubber d. Polyethylene
    7·1 answer
  • If the half-life of a 20.0 g sample is known to be 24 minutes, how long will it take for only 5.0 grams of the sample to remain?
    6·2 answers
  • What is ph level of acid rain​
    14·1 answer
  • Label the particles, charges, &amp; mass for Elements: 6, 8 &amp; 10?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!