1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BARSIC [14]
3 years ago
9

Which techniques would be best for separating a

Chemistry
1 answer:
pashok25 [27]3 years ago
6 0

Answer: centrifugation, boiling/heating , and long standing

Explanation:

You might be interested in
Most enzymes work best at 37C because at lower and higher temperatures, the conditions are not optimal for their performance. Ex
finlep [7]

That's because the solubility

  • Temperature is directly proportional to solubility

Higher the solubility higher the temperature

Lower the temperature lower the solubility

So

Less temperature makes enzymes work faster

3 0
2 years ago
Select all that apply.
tekilochka [14]
Answer is:<span>increase [Cl</span>₂<span>] and remove HCl from the product.
</span>Chemical reaction: Cl₂ + CH₂Cl₂ → CHCl₃(chloroform) + HCl.
According to Le Chatelier's Principle, the position of equilibrium moves to counteract the change, the position of equilibrium will move so that the concentration of reactants decrease (Cl₂) and concentration of products of chemical reaction increase (CHCl₃) if increase concentration of reactants and decrease concentration of products.

 


3 0
3 years ago
A buffer can be prepared by mixing two solutions. Determine if each of the following mixtures will result in a buffer solution o
GenaCL600 [577]

Answer:

The answers are in the explanation

Explanation:

A buffer is the mixture of a weak acid with its conjugate base or vice versa. Thus:

<em>1)</em> Mixing 100.0 mL of 0.1 M HF with 100.0 mL of 0.05 M mol KF. <em>Will </em>result in a buffer because HF is a weak acid and KF is its conjugate base.

<em>2)</em> Mixing 100.0 mL of 0.1 M NH₃ with 100.0 mL of 0.1 M NH₄Br. <em>Will not </em>result in a buffer because NH₃ is a strong base.

<em>3) </em>Mixing 100.0 mL of 0.1 M HCN with 100.0 mL of 0.05 M KOH. <em>Will </em>result in a buffer because HCN is a weak acid and its reaction with KOH will produce CN⁻ that is its conjugate base.

<em>4)</em> Mixing 100.0 mL of 0.1 M HCl with 100.0 mL of 0.1 M KCl <em>Will not </em>result in a buffer because HCl is a strong acid.

<em>5)</em> Mixing 100.0 mL of 0.1 M HCN with 100.0 mL of 0.1 M KOH <em>Will not </em>result in a buffer because each HCN will react with KOH producing CN⁻, that means that you will have just CN⁻ (Conjugate base) without HCN (Weak acid).

I hope it helps!

6 0
3 years ago
Name 3 common accelerants used in arson
Makovka662 [10]

Answer:

Common ones are Gasoline, Diesel fuel, and Kerosene.

Explanation:

Many accelerants are hydrocarbon-based fuels, sometimes referred to as petroleum distillates: gasoline, diesel fuel, kerosene, turpentine, butane, and various other flammable solvents. These accelerants are also known as ignitable liquids. Ignitable liquids can leave behind tell-tale marks in the fire debris.

Hoped this had helped you :)

7 0
3 years ago
HELPPP
Licemer1 [7]

Answer:

79 protons.

Explanation:

8 0
2 years ago
Other questions:
  • An elimination reaction can best be described as a reaction in which an elimination reaction can best be described as a reaction
    13·1 answer
  • Why would scientists change their ideas? *<br> Need help
    6·2 answers
  • Which element has similar properties to Berylium? Explain
    7·1 answer
  • Resistance of a material being scratched in known as
    11·2 answers
  • after a chemistry student made a AgNO3(small 3 at bottom) solution., she wanted to determine the molar concentration of it. if 2
    8·1 answer
  • Burning gasoline as fuel for a car involves
    11·2 answers
  • DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
    6·1 answer
  • What amount of water is formed when 20 ml of 0.80 m hcl and 30 ml of 0.40 m naoh are mixed?
    14·1 answer
  • Iron chloride + sodium hydroxide​
    6·1 answer
  • for each compound write a complete reaction equation showing the removal of the atoms that become the water molecule
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!