1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anon25 [30]
3 years ago
5

A model of an oxygen atom is shown below. What’s the electrical charge of this ion. Hint a neutral oxygen atom has 8 protons and

8 electrons
Chemistry
1 answer:
artcher [175]3 years ago
5 0

Answer:

-2

Explanation:

The model of the oxygen atom will probably have an electrical charge of -2.

Now let us explain how to find the charge on any atom.

The charge on an atom is the number of electrons gained or lost by specie. Electrons are usually lost in any atom so that they can attain stability.

These electrons are removed from the valence shell because they are the outermost shell electrons. They are most weakly held electrons in an atom.

An atom of oxygen has:

     8 electrons with a configuration of 1s² 2s² 2p⁴

   Charge = number of protons - number of electrons

        neutral oxygen has 8 electrons and protons, charge is 0

You might be interested in
How many moles of H atoms are there in 2 moles of CH3CH2CH2CH3?
Advocard [28]

AnSweR: 10

ExplanAtion: My random idiot friend just told me

3 0
2 years ago
Which of the following are polyatomic ions? Check all that apply
stellarik [79]

Answer:

NH4 is the correct ans

Explanation:

Mark as brainliest

6 0
3 years ago
How many molecules are there in 122 grams of Cu(NO3)2?
ipn [44]
Cu =63.5
2 times N =28.02
6 times O =96
96=63.5=28.02=127.07
122/127.07=.96 molecules
6 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
2 years ago
10 divided by 2 im confused
Eddi Din [679]

if your serious about this question then it is 5

4 0
3 years ago
Read 2 more answers
Other questions:
  • Why should carbonated beverages be kept cold?
    8·1 answer
  • Which element is malleable and can conduct electricity in the solid phase?
    5·2 answers
  • Question 4(Multiple Choice Worth 4 points)
    11·2 answers
  • Please Help....................
    15·2 answers
  • Carbon-14 dating assumes that the carbon dioxide on earth today has the same radioactive content as it did centuries ago. if thi
    12·1 answer
  • Which of the following rights is granted by the Fifth Amendment?
    9·1 answer
  • Which picture best illustrates thermal energy transfer by conduction?
    5·2 answers
  • How many total atoms are there in 69.1 g of ammonia (NH3)?​
    9·1 answer
  • StitchXpika plzzzzzzzzz
    15·1 answer
  • Name and Title:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!