1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lord [1]
3 years ago
12

Total distance divided by total elapsed time gives what quantity?

Chemistry
1 answer:
ki77a [65]3 years ago
6 0
<h2>Total distance divided by total elapsed time gives : Average speed </h2>

Explanation:

Speed

It is the distance traveled by body with respect to time .

Its formula is Speed = distance /time

V=S/T

units : m/sec or Km/hr

Distance

It is total path traveled by body in any direction .

It unit and symbol is : S  and unit = m /Km

Average speed

It is the total distance traveled by body with respect to total time taken to travel that given distance .

Average speed = total distance /total time

A.s = T.D/T.T

unit = m/sec or Km/hr

Instantaneous velocity

It is the distance traveled by body at particular instant of time ,in given direction .

Displacement

It is the shortest path traveled by body in given direction .

You might be interested in
Look at the following enthalpy diagram. Select all that apply.
Drupady [299]

Answer:

Option 2 and 4 are correct

Explanation:

The reactants in the attached image have more enthalpy and hence less stability as they are more reactive. Thus, Product is more stable than the reactants.

This is an addition reaction in which two reactants add up to form the product.

Very less activation energy is required as the reactants themselves are unstable, possess high energy and hence are very reactive.

Reactants have more energy than the products.  

5 0
3 years ago
How many moles of PC15 can be produced from 58.0 g of Cl₂ (and excess<br> P4)?
ludmilkaskok [199]

0.3268 moles of PC15 can be produced from 58.0 g of Cl₂ (and excess

P4)

<h3>How to calculate moles?</h3>

The balanced chemical equation is

P_{4}  + 10Cl_{2}  = 4PCl_{5}

The mass of clorine is m(Cl_{2}) = 58.0 g

The amount of clorine is n(Cl_{2}) = m(Cl_{2})/M(Cl_{2}) = 58/70.906 = 0.817 mol

The stoichiometric reaction,shows that

10 moles of Cl_{2} yield 4 moles of PCl_{5};

0.817 of Cl_{2} yield x moles of PCl_{5}

n(PCl_{5}) = 4*0.817/10 = 0.3268 mol

To know more about stoichiometric reaction, refer:

brainly.com/question/14935523

#SPJ9

3 0
2 years ago
This is an example of a mixture that will separate______.
devlian [24]

B is the correct answer

6 0
3 years ago
Which index fossil is most likely to be found in<br> the Allegheny Plateau?
Usimov [2.4K]

Answer:

amphibians

Explanation:

please mark this answer as brainliest

5 0
3 years ago
The octet rule states that the formula for a compound is derived by Group of answer choices having a net charge of magnitude 8.
balandron [24]

Answer:

Atoms bonds with 8 electrons

Explanation:

Octet rule is a chemical rule that shows elements in main group bond so that each atom have 8 valence electrons in the outmost shell which make them to have similar electronic configuration with Noble gases This is important because the sharing of electrons make atoms to have full shell. Atoms with electrons not up to 8 react with more stable compound.

6 0
3 years ago
Other questions:
  • According to the periodic table, which two elements are in the same row? A. copper and gold B. sodium and sulfur C. lithium and
    15·1 answer
  • How many orbital blocks are represented in this<br> periodic table?
    7·2 answers
  • Which of these pairs of elements have the same number of valence electrons?
    12·2 answers
  • Utherford proposed that atoms have positive nuclei which statement correctly describes the nucleus of an atom?
    5·1 answer
  • Please answer this I need it answered really soon thank you so much whoever answers this and I will give BRAINLIEST!!
    11·2 answers
  • Which substance increases in solubility as the temperature decreases?
    6·2 answers
  • 5. Why do water droplets form on the outside of a glass of cold soda?
    13·2 answers
  • Explain how knowledge of acids/bases and neutralization can apply to the treatment of soil acidification
    8·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Select the correct term to complete each sentence.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!