1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Diano4ka-milaya [45]
3 years ago
13

How can endangered species be saved ?

Chemistry
2 answers:
labwork [276]3 years ago
5 0

Answer:

There are lots of methods.

Explanation:

Usually, animals like pandas live a shorter lifespan in the wild than in captivity. A little fact, there is only one brown panda in the entire world, so it would be very, very rare to see one. The Smithsonian National Zoo, for example, are working to protect pandas, as well as other species.

MatroZZZ [7]3 years ago
3 0

Answer:

Protection

Explanation:

Different types of supporting by wildlife habitats, Joining of Endangered species programs.

You might be interested in
What would happen if an alkali metal was combined with a halogen?explain ​
RideAnS [48]
All alkail metals react with halogens vigorously to produce salt. The alkali metal would loose an electron to form and ion with the halogen
7 0
4 years ago
Suppose 0.795 g of sodium iodide is dissolved in 100. mL of a 39.0 m M aqueous solution of silver nitrate.
lubasha [3.4K]

Answer:

The final molarity of iodide anion is 0.053 M

Explanation:

<u>Step 1</u>: Data given

Mass of sodium iodide (NaI) = 0.795 grams

Volume of the solution = 100 mL = 0.1 L

Molarity of aqueous solution of silver nitrate (AgNO3) = 39 mM = 0.039M

The molecular mass of sodium iodide is 149.89 g/mol.

<u>Step 2:</u> The balanced equation

AgNO3(aq) + NaI(aq) → AgI(s) + NaNO3(aq)

<u>Step 3: </u>Calculate number of moles of sodium iodide

Moles NaI = mass NaI / Molar mass NaI

Moles NaI = 0.795 grams / 149.89 g/mol

Moles NaI = 0.0053 moles

For 1 mole AgNO3 consumed, we need 1 mole NaI to produce 1 mole AgI and 1 mole NaNO3

The sodium iodide will dissociate as followed:

NaI(aq) → Na+(aq) +  I-(aq)

<u>Step 4</u>: Calculate iodide ions

For 1 mole NaI, we have 1 mole of I-

For 0.0053 moles of NaI we'll have 0.0053 moles I-

<u>Step 5:</u> Calculate molarity of iodide ion

Molarity = moles I- / volume

Molarity I- = 0.0053 moles / 0.1 L

Molarity I- = 0.053 M

The final molarity of iodide anion is 0.053 M

5 0
3 years ago
How would a student justify inferring that “indigenous” means “originating in a particular region”
denpristay [2]

In order to understand the meaning of the word "indigenous" , we have to break the word as

Indi + gen + ous

Here "Gen" means birth (like genesis: generation of something)

"Ous" means bearing some properties related to something

like marvelous : having property known as marvel.

Thus indigenous means having property of place where birth was taken

Thus it is originating in a particular region

The word root "gen" means "birth," and the suffix "-ous" means "having the quality of something."

8 0
3 years ago
Could you separate the sodium from the chlorine by crushing the salt crystals
Zigmanuir [339]
No, you cannot.

The distinction is made in the fact that the sodium and chlorine atoms are bonded chemically, while the crushing of the salt is a physical change. A physical change is one that does not have the ability to change the identity of the substance. Such changes include crushing, boiling, melting. In order to separate the chlorine and sodium atoms, you must make them undergo a chemical change, for example add the salt to sulfuric acid and make it react.
6 0
3 years ago
In a calcium atom in the ground state, the electrons that possess the least amount of energy are located in the(1) first electro
Pachacha [2.7K]
The first electron shell.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which one of the following pair has the same number of ions?
    14·2 answers
  • A substance is present in the gaseous state at room temperature. Which of the following best explains the probable position of t
    7·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • When DNA is replicated, it is necessary for the two strands to "unzip" temporarily. Choose which bonding type is most appropriat
    9·1 answer
  • Modern atomic theory states that atoms are neutral. How is this neutrality achieved?​
    10·2 answers
  • ASAP!!!
    10·1 answer
  • 24 grams of CH4 was added to the above reaction. Calculate the theoretical yield of CO2. A. 66 grams B. 33 grams c. 132 grams. D
    7·1 answer
  • Compared to orange light, violet light
    10·1 answer
  • During photosynthesis, the following reaction takes place: carbon dioxide + water + light energy → sugar + oxygen During cellula
    8·1 answer
  • Which of the following powers the water cycle?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!