1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enyata [817]
3 years ago
10

Which statement best describes the compressibility of a gas?

Chemistry
1 answer:
LiRa [457]3 years ago
5 0
Gas however can be greatly compressed. Maybe think of scuba tanks or whatever. They force the air into a fixed volume. Even when the tank if full more air can be put in because of the compressable nature of gas.<span>
</span>
You might be interested in
A particle that has a negative charge Electrons Protons Non-polarMolecule Neutrons
murzikaleks [220]
Electron 

 ~~~hope this helps~~~
~~have a beautiful day~~
           ~davatar~
7 0
3 years ago
Why are there so many different kind of apples
Mars2501 [29]
There are many different types of apples i dont EXACTLY know why but however there are some eople that can only have a certain type of apple
8 0
3 years ago
In 1939, at the age of 20, a man stood 270 cm tall (over 8 1/2 feet) and wore size 37 shoes! The hormonal disorder from which he
rodikova [14]

Answer:

Somatotropin(Growth Hormone)

Explanation:

-Uncontrolled growth in a person is usually caused by the excessive secretion of growth hormone.

-This hormone is also known as Somatotropin.

-This hormone is produced  in the pituitary  gland.

3 0
3 years ago
Which term describes rocks that absorb water?
KIM [24]

Answer:

C. porous

hope it helps!!!

please mark as the brainliest if it is correct!

8 0
2 years ago
When carbon is burned in air, it reacts with oxygen to form carbon dioxide. When 14.4 g of carbon were burned in the presence of
Yanka [14]

Answer:

Mass of carbon dioxide produced = 52.8 g

Explanation:

Given data:

Mass of carbon react = 14.4 g

Mass of oxygen = 56.5 g

Mass of oxygen left = 18.1 g

Mass of carbon dioxide produced = ?

Solution:

C + O₂     →      CO₂

Number of moles of C:

Number of moles = mass/ molar mass

Number of moles = 14.4 g/ 12 g/mol

Number of moles = 1.2 mol

18.1 g of oxygen left it means carbon is limiting reactant.

Now we will compare the moles of C with CO₂.

                       C             :         CO₂

                        1             :          1

                      1.2           :          1.2

Mass of CO₂:

Mass = number of moles × molar mass

Mass = 1.2  mol × 44 g/mol

Mass = 52.8 g

8 0
2 years ago
Other questions:
  • Calculate ΔrG∘ at 298 K for the following reactions.CO(g)+H2O(g)→H2(g)+CO2(g)2-Predict the effect on ΔrG∘ of lowering the temper
    6·1 answer
  • The strongest bases are hydroxides
    6·2 answers
  • 10 Points
    10·1 answer
  • Explain how there can be so many different kinds of suntances in the world
    5·2 answers
  • This is the type of attraction that holds elements like nickel, sodium and gold together. For these elements, stationary, positi
    14·2 answers
  • All organisms need to obtain _?__ from food to survive
    15·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • WILL MARK BRAINLIEST please
    8·1 answer
  • 9. Mr. James owns 12 gas stations in Newport News. He wants to build a
    15·1 answer
  • The wavelength of the violet light emitted from a hydrogen atom is 410.1 nm. This light is a result of electronic transitions be
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!