1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hitman42 [59]
3 years ago
10

Give regents and mechanism

Chemistry
1 answer:
Kryger [21]3 years ago
4 0

Answer:

Reagents: 1) BH_3 2) H_2_O2, OH^-

Mechanism: Hydroboration

Explanation:

In this case, we have a <u>hydration of alkene</u>s reaction. But, in this example, we have an <u>anti-Markovnikov reaction</u>. In other words, the "OH" is added in the least substituted carbon. Therefore we have to choose an anti-Markovnikov reaction: <u>"hydroboration"</u>.

The <u>first step</u> of this reaction is the addition of borane (BH_3) to the double bond. Then in the <u>second step</u>, we have the deprotonation of the hydrogen peroxide, to obtain the peroxide anion. In the <u>third step</u>, the peroxide anion attacks the molecule produced in the first step to produce a complex compound in which we have a bond "BH_2-O-OH". In <u>step number 4</u> we have the migration of the C-B bond to oxygen. Then in <u>step number 5</u>, we have the attack of OH^- on the O-BH_2 to produce an alkoxide. Finally, the water molecule produce in step 2 will <u>protonate</u> the molecule to produce the alcohol.

See figure 1

I hope it helps!

You might be interested in
What percentage of the mass of hydrofluoric acid (HF) is contributed by hydrogen?
Morgarella [4.7K]

This problem is asking for the percent by mass of hydrogen in hydrofluoric acid. At the end, the answer turns out to be D. 5%​ as shown below:

<h3>Percent compositions:</h3>

In chemistry, percent compositions are used for us to know the relative amount of a specific element in a compound. In order to do so for hydrogen, we use the following formula, which can also be applied to any other element in a given compound:

\% H=\frac{m_H*1}{M_{HF}}*100\%

Where m_H stands for the atomic mass of hydrogen and M_{HF} for the molar mass of hydrofluoric acid. In such a way, we plug in the atomic masses of hydrogen (1.01 g/mol) and fluorine (19.0 g/mol) to obtain:

\% H=\frac{1.01g/mol*1}{1.01g/mol+19.0g/mol}*100\%\\\\\% H=5\%

Learn more about percent compositions: brainly.com/question/12247957

5 0
2 years ago
Chemistry
Aleks [24]

Answer:

A. High electrical conductivity

Explanation:

solid silver isn't brittle, it has a high melting point, and its not a good insulator.

4 0
3 years ago
Which type of solid can become an electrical conductor via chemical substitution?
Ludmilka [50]
Covalent-network solids
8 0
3 years ago
Read 2 more answers
Based on the molecular formula, determine whether each compound is an alkane, alkene, or alkyne. (Assume that the hydrocarbons a
topjm [15]

Answer:

a. alkyne

b. alkane

c. alkyne

d. alkene

Explanation:

The general formula for each class of compound is given below

Alkane: C_nH_{2n+2}

Alkene: C_nH_{2n}

Alkyne: C_nH_{2n-2} (assuming single multiple bonds)

Now let us classify according to the above formulas:

a. It has two hydrogen atoms less than the two times of carbon atoms hence, it's alkyne

b. It has two hydrogen atoms more than the two times of carbon atoms hence, it's alkane

c. It has two hydrogen atoms less than the two times of carbon atoms hence, it's alkyne

d. It has hydrogen atoms two times of carbon atoms hence, it's alkene

5 0
3 years ago
Read 2 more answers
Notice the populations decrease as you go from the bottom of the food chain to the top. Why do you think this is so?
kodGreya [7K]
Exactly what the person above me said
5 0
3 years ago
Read 2 more answers
Other questions:
  • Nitrogen dioxide decomposes to nitric oxide and oxygen via the reaction: 2NO2 → 2NO + O2 In a particular experiment at 300 °C, [
    5·1 answer
  • What do scientists use to increase the surface area of a solute? heat a beaker a mortar and pestle a flask a stir bar
    11·2 answers
  • Natural remedies are usually more effective and safer because they have thoroughly tested .
    13·1 answer
  • Heat flow is the ________of energy from a waemer object to a cooler one. whats the blank??​
    9·1 answer
  • If mass increases what must happen to the force in order to achieve the same change in motion
    9·1 answer
  • The following reaction was monitored as a function of time: A→B+C A plot of ln[A] versus time yields a straight line with slope
    6·1 answer
  • PLEASE ANSWER
    13·1 answer
  • These four ELEMENTS were found in early earth and they make up all living things.
    9·2 answers
  • What would school look like on mars in a 100 years?
    13·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!