1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wlad13 [49]
2 years ago
12

The muscular system and the skeletal system work together so the body can _____

Biology
2 answers:
leva [86]2 years ago
5 0
Hello There.


Choice A. Looks Like The Best Answer To This Question.


Hope This Helped! 

Have A Great Day! :D
ivanzaharov [21]2 years ago
4 0
A. move :) is the best choice that i got
You might be interested in
____does not favor survival traits, but a desired outcome
morpeh [17]
The answer could possibly be natural selection or survival of the fittest
4 0
3 years ago
Charles darwin suggested that atolls begin as coral reefs around volcanic islands. Will Surtsey island-icelands newest volcanic
Kaylis [27]

Answer:

No.

Explanation:

No, Surtsey island and Iceland newest volcanic island will not become an atoll because these islands have no underground volcanoes. The atolls are only occur when the volcanoes are present underwater and we know that these volcanoes are present on the lands not in the water so there is no possibility of having atolls in these Surtsey and Iceland volcanic islands

8 0
2 years ago
In the block to polyspermy, entry of the sperm's contents causes ________ levels in the oocyte's cytoplasm to rise, triggering t
crimeas [40]

In the block to polyspermy, entry of the sperm's contents causes calcium ion levels in the oocyte's cytoplasm to rise, triggering the cortical reaction.

In biology, polyspermy describes the fertilization of an egg by more than one sperm. Diploid organisms normally contain two copies of each chromosome, one from each parent.

The cell resulting from polyspermy, on the other hand, contains three or more copies of each chromosome—one from the egg and one each from multiple sperm. Usually, the result is an unviable zygote. This may occur because sperm are too efficient at reaching and fertilizing eggs due to the selective pressures of sperm competition.

The cortical reaction is a calcium-dependent exocytotic process in which the content of secretory granules is released into the perivitellin space immediately after fertilization, which serves to prevent polyspermic fertilization.

Learn more about  polyspermy here : brainly.com/question/4537960

#SPJ4

8 0
11 months ago
What substance do you think reacts with a cut apple to turn it brown?
lidiya [134]
Jajsheheheuwiwhehdhdhsbsidjjs
7 0
2 years ago
What is NOT a function of the
Arada [10]

Answer:

function as the powerhouse of cell

Explanation:

we have read the power house of cell as a mitochondria

8 0
3 years ago
Read 2 more answers
Other questions:
  • In a human karyotype, chromosomes are arranged in 23 pairs. If we choose one of these pairs, such as pair 14, what do the two ch
    11·1 answer
  • Name of the vector and the species of the parasite that cause the disease Malaria in Africa
    8·1 answer
  • Classify each description as true of introns only, exons only, or both.A-present in eukaryotic genomesB-generally absent from ba
    15·1 answer
  • Sperm tails in the fruit fly Drosophila bifurca can reach up to 6cm long, which is over 20 times the length of the organism itse
    11·1 answer
  • Mltochondria are the<br> of the cell.
    12·2 answers
  • The river source supports little life outside of invertebrates. For each of the organisms listed below. Give one adaption that h
    8·1 answer
  • Give a scenario where a cell may need to perform a form of endocytosis and exocytosis
    15·2 answers
  • HELP NEED ANSWER QUICK!!!!
    5·2 answers
  • After you eat lunch, nerve cells in your stomach respond to the distension (the stimulus) resulting from the food. This is best
    8·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!