1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
____ [38]
3 years ago
13

Can someone help me with this please....​

Chemistry
1 answer:
Anna007 [38]3 years ago
6 0

a. vinegar

b. Mineral deficiencies in the body can make joint pain worse. Because Vinegar contains the calcium, magnesium, potassium, and phosphorus your body needs, it helps as a supplement and therefore reduces pain.

1. in making fertilisers which are chemical compounds or salts to increase fertility of soil.

2. lithium hydroxide is used in space because of its high absorption of carbon dioxide and the small amount of heat produce by the reaction.

3. Acid rain has a lower pH than "normal" rain . Rain is naturally somewhat acidic with a pH between 5.0-5.5 typically. Acid rain has a pH that is below this: 4.4-4.2

4. lemon juice is an anti bacterial and a good germicidal solution which helps in removing the unseen bacteria on our hands.

<h3>Hope this helps :)</h3>
You might be interested in
If you have the equation
garri49 [273]
Assuming the conditions of the reaction are maintained and appropriate for the reaction to still occur, the reaction rate can be affected by increasing the concentration of the reagents used in a reaction. It will speed it up.
6 0
3 years ago
Balance the equation below for the reaction between hydrogen and chlorine, using the smallest whole-number
Elanso [62]
H2(g) + Cl2(g) = 2 HCl(aq) (balanced equation)
1, 1, 2 (coefficients)
3 0
3 years ago
*click image*
nadya68 [22]

Answer:

Its be 1,2 and 4.

Explanation:

Since changing the direction won't do anything to a electric magnet.

6 0
3 years ago
1. How can you make a solid solute dissolve into solution faster?
nydimaria [60]
The correct answer to your question is B,, make the solute particles smaller.
let me know if you have any further questions
:)
3 0
3 years ago
How do electrons typically fill energy levels?
fenix001 [56]
The electrons fill energy levels from the lowest available energy level, based of three typical rules.

1) Follow Aufbau rule: fill from lower to higher energy levels (1s, 2s, 2p, 3s, 3p, 4s, 3d, 4p, 5s, 4d, 5p, 6s, 4f, 5d, 6p, 7s, 5f, 6d, 7p)

2) Pauly exclusion principle: two electrons can not have the same four quantum numbers

3) Hund rule: if the orbitals have the same energy, the electrons must go to different orbitals before two occupies the same orbital.


7 0
3 years ago
Other questions:
  • In the following reaction: Mg + 2HCl → MgCl2 + H2 How many liters of H2 would be produced if you started with 24.3 g of Mg?
    5·1 answer
  • Which of these is the lowest subgroup? kingdom, order, genus, or species.
    15·2 answers
  • The mass of a watch glass was measured four times. The masses were
    9·2 answers
  • Help me plzzzzzzzz it helps a lot
    11·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which substance could any excess not be removed by filtration​
    6·1 answer
  • Help help help plsss
    11·1 answer
  • Which term best describes a unit of carbon dioxide?
    9·1 answer
  • If you have a saturated solution at equilibrium, what changes could you make to increase the solubility of the compound?.
    10·1 answer
  • Iansiqnsdijsijnweijnjwn
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!