1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
joja [24]
3 years ago
11

This question refers to the mRNA sequence below:

Engineering
1 answer:
Naily [24]3 years ago
7 0

Answer:

Serine

Explanation:

The genetic code indicates the way by which the four bases of the messenger RNA (i.e., Adenine, Uracil, Guanine and Cytosine) are read in the ribosome to convert them into a protein. In this code, each codon is composed of three nucleotides that encode a single amino acid. Serine (S) residue can be synthesized by AGC (as in this case), AGU, UCA, UCC, UCG and UCU codons. The sequence above indicated (AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA) will be traduced in the following 5'-3' Frame:  S-WAGAEKVR-, where the second codon is a stop codon (UGA).

You might be interested in
How can you evaluate whether the slope of the dependent variable with an independent variable is the same for each level of the
s2008m [1.1K]

Answer:

By running multiple regression with dummy variables

Explanation:

A dummy variable is a variable that takes on the value 1 or 0. Dummy variables are also called binary

variables. Multiple regression expresses a dependent, or response, variable as a linear

function of two or more independent variables. The slope is the change in the response variable. Therefore, we have to run a multiple regression analysis when the variables are measured in the same measurement.The number of dummy variables you will need to capture a categorical variable

will be one less than the number of categories. When there is no obvious order to the categories or when there are three or more categories and differences between them are not all assumed to be equal, such variables need to be coded as dummy variables for inclusion into a regression model.

3 0
3 years ago
Air enters a tank through an area of 0.2 ft2 with a velocity of 15 ft/s and a density of 0.03 slug/ft3. Air leaves with a veloci
Mademuasel [1]

Answer:

please find attached.

Explanation:

4 0
4 years ago
50.38
klemol [59]

Answer:

International Building Code (IBC)

Explanation:

6 0
2 years ago
A circular hoop sits in a stream of water, oriented perpendicular to the current. If the area of the hoop is doubled, the flux (
natka813 [3]

Answer:

The flux (volume of water per unit time) through the hoop will also double.

Explanation:

The flux = volume of water per unit time = flow rate of water through the hoop.

The Flow rate of water through the hoop is proportional to the area of the hoop, and the velocity of the water through the hoop.

This means that

Flow rate = AV

where A is the area of the hoop

V is the velocity of the water through the hoop

This flow rate = volume of water per unit time = Δv/Δt =Q

From all the above statements, we can say

Q = AV

From the equation, if we double the area, and the velocity of the stream of water through the hoop does not change, then, the volume of water per unit time will also double or we can say increases by a factor of 2

3 0
4 years ago
1. A 260 ft (79.25 m) length of size 4 AWG uncoated copper wire operating at a tem-
Murljashka [212]

A 260 ft (79.25m) length of size 4 AWG uncoated copper wire operating at a temperature of 75°c has a resistance of 0.0792 ohm.

Explanation:

From the given data the area of size 4 AWG of the code is 21.2 mm², then K is the Resistivity of the material at 75°c is taken as ( 0.0214 ohm mm²/m ).

To find the resistance of 260 ft (79.25 m) of size 4 AWG,

R= K * L/ A

K = 0.0214 ohm mm²/m

L = 79.25 m

A = 21.2 mm²

R = 0.0214 * \frac{79.25}{21.2}

  = 0.0214 * 3.738

  = 0.0792 ohm.

Thus the resistance of uncoated copper wire is 0.0792 ohm

5 0
4 years ago
Other questions:
  • Water at 20oC, with a free-stream velocity of 1.5 m/s, flows over a circular pipe with diameter of 2.0 cm and surface temperatur
    13·1 answer
  • Find the mass if the force is 18 N and the acceleration is 2 m/s2
    8·2 answers
  • A Coca Cola can with diameter 62 mm and wall thickness 300 um has an internal pressure of 100 kPa. Calculate the principal stres
    9·1 answer
  • Project 8:The Harris-Benedict equation estimates the number of calories your body needs to maintain your weight if you do no exe
    5·1 answer
  • In which forms do MOST of the Sun's energy reach Earth's surface?
    15·1 answer
  • Determine the combined moment about O due to the weight of the mailbox and the cross member AB. The mailbox weighs 3.2 lb and th
    14·1 answer
  • According to the video, what are some tasks that Construction Managers perform? Check all that apply.
    9·2 answers
  • Assignment # 2
    5·1 answer
  • How many ase certifications are there for automotive technicians?
    7·1 answer
  • On what kind of sectional drawing would you find the maximum length of a building?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!