All categories

3 years ago

This question refers to the mRNA sequence below:

Engineering

1 answer:

Naily [24]3 years ago

7 0

Answer:

Serine

Explanation:

The genetic code indicates the way by which the four bases of the messenger RNA (i.e., Adenine, Uracil, Guanine and Cytosine) are read in the ribosome to convert them into a protein. In this code, each codon is composed of three nucleotides that encode a single amino acid. Serine (S) residue can be synthesized by AGC (as in this case), AGU, UCA, UCC, UCG and UCU codons. The sequence above indicated (AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA) will be traduced in the following 5'-3' Frame: S-WAGAEKVR-, where the second codon is a stop codon (UGA).

You might be interested in

In a wheatstone bridge three out of four resistors have of 1K ohm each ,and the fourth resistor equals 1010 ohm. If the battery

Dima020 [189]

Answer:

248.756 mV

49.7265 µA

Explanation:

The Thevenin equivalent source at one terminal of the bridge is ...

voltage: (100 V)(1000/(1000 +1000) = 50 V

impedance: 1000 || 1000 = (1000)(1000)/(1000 +1000) = 500 Ω

The Thevenin equivalent source at the other terminal of the bridge is ...

voltage = (100 V)(1010/(1000 +1010) = 100(101/201) ≈ 50 50/201 V

impedance: 1000 || 1010 = (1000)(1010)/(1000 +1010) = 502 98/201 Ω

The open-circuit voltage is the difference between these terminal voltages:

(50 50/201) -(50) = 50/201 V ≈ 0.248756 V . . . . open-circuit voltage

The current that would flow is given by the open-circuit voltage divided by the sum of the source resistance and the load resistance:

(50/201 V)/(500 +502 98/201 +4000) = 1/20110 A ≈ 49.7265 µA

8 0

3 years ago

Consider a 1.80-m-tall man standing vertically in water and completely submerged in a pool. Determine the difference between the

defon

Answer:

17.658 kPa

Explanation:

The hydrostatic pressure of a fluid is the weight of a column of that fluid divided by the base of that column.

$P = \frac{weight}{base}$

Also, the weight of a column is its volume multiplied by it's density and the acceleration of gravity:

$weight = \delta * v * g$

Meanwhile, the volume of a column is the area of the base multiplied by the height:

$V = base * h$

Replacing:

$P = \frac{\delta * base * h * g}{base}$

The base cancels out, so:

$P = \delta * h * g$

The pressure depends only on the height of the fluid column, the density of the fluid and the gravity.

If you have two point at different heights (or depths in the case of objects submerged in water) each point will have its own column of fluid exerting pressure on it. Since the density of the fluid and the acceleration of gravity are the same for both points (in the case of hydrostatics density is about constant for all points, it is not the case in the atmosphere), we can write:

$\Delta P = \rho * g * (h1 - h2)$

We do not know at what depth the man of this problem is, but it doesn't matter, because we know the difference in height of the two points of interes (h1 - h2) = 1.8 m. So:

$\Delta P = 9.81 \frac{m}{s^{2} } * 1000 \frac{kg}{m^3} * 1.8 m = 17658 Pa = 17.658 kPa$

4 0

3 years ago

A turbojet aircraft is flying with a velocity of 280 m/s at an altitude of 9150 m, where the ambient conditions are 32 kPa and -

artcher [175]

Answer:

(a) The velocity of the exhaust gases. is 832.7 m/s

(b) The rate of fuel consumption is 0.6243 kg/s

Explanation:

For the given turbojet engine operating on an ideal cycle, the pressure ,temperature, velocity, and specific enthalpy of air at $i^{th}$ state are $P_i$ , $T_i$ , $V_i$ , and $h_i$ , respectively.

Use "ideal-gas specific heats of various common gases" to find the properties of air at room temperature.

Specific heat at constant pressure, $c_p$ = 1.005 kJ/kg.K

Specific heat ratio, k = 1.4

3 0

4 years ago

A student wants to restate some ideas she found in a journal article by a prominent expert in economics. She combines her own wo

kipiarov [429]

Explanation:

Althought she referenced the article at the end, is imposible to know which part of the article is hers and which part is the expert's so that would be plagiarism.

If she used quotation marks in the words of the expert it would be clear and no plagiarism could be accused.

4 0

3 years ago

Supercharging is the process of (a) Supplying the intake of an engine with air at a density greater than the density of the surr

iVinArrow [24]

Answer:

a)supplying the intake of an engine with air at a density greater than the density of the surrounding atmosphere

Explanation:

Supercharging is the process of supplying the intake of an engine with air at a density greater than the density of the surrounding atmosphere.

By doing this , it increases the power out put and increases the brake thermal efficiency of the engine.It also increases the volumetric efficiency of the engine.

So the our option a is right.

4 0

3 years ago