1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
3 years ago
6

Write a complete, balanced chemical equation where tin metal reacts with aqueous hydrochloric acid to produce tin(II) chloride a

nd hydrogen gas. Include states.
From the equation, which element is oxidized, and which element is reduced?
Chemistry
1 answer:
Naily [24]3 years ago
7 0

Answer:

Zn(s)+2HCl(aq)→ZnCl2(aq)+H2(g)

Explanation:

The net reaction is Z n ( s ) + 2 H + ( a q ) → Z n 2 + ( a q ) + H 2 ( g ) The C l − ions are spectators - they don't change.

You might be interested in
PLEASE HELP<br><br> is this a chemical or physical change???
skad [1K]

Answer:

Chemical, cause physical are changes affecting the form of a chemical substance, but not its chemical composition. This doesn't affect the substance but the composition.

Explanation:

5 0
3 years ago
Read 2 more answers
Magnesium oxide (MgO) forms when the metal burns in air. (a) If 1-25 9 of MgO contains 0.754 g of Mg, what is the mass ratio of
Vsevolod [243]

Answer:

Explanation:

a )

1.25 g MgO contains .754 g of Mg .Rest will be O

so oxide = 1.25 - .754 = 0.496 g

ratio of magnesium to oxide = .754/.496 = 1.52

b) 1.25 g of MgO contains .754 g of Mg

534 g of MgO contains .754 x 534 / 1.25 g = 322.11 g

5 0
3 years ago
Calculate the boiling point of a solution of 500.0 g of ethylene glycol (c2h6o2) dissolved in 500.0 g of water. kf = 1.86°c/m a
Bingel [31]

Answer:The boiling point of the solution is 108° C.

Explanation:

Boiling point of pure water=T=100^oC

Boiling point of water after addition of 500 g of ethylene glycol=T_f

Mass of water = 500g = 0.5 kg (1000 g = 1 kg)

\Delta T_f=K_b\times \frac{\text{Mass of ethlyene glycol}}{\text{Molar mass of ethylene glycol}}

\Delta T_f=0.512^oC/m\times \frac{500 g}{62.07 g/mol\times 0.5 kg}

\Delta T_f=8.24 ^oC

\Delta T_f=T_f-T

8.24^oC=T_f-100^oC

T_f=108.24^oC

The boiling point of the solution is 108° C.

7 0
3 years ago
How does the law of conservation of mass apply to this reaction C2H4 + O2 &gt; 2H2O + 2CO2
AlexFokin [52]
It shows mass is not created nor lost but re arranged
4 0
3 years ago
Read 2 more answers
 A chemist describes a particular experiment in this way: "0.0400 mol of H2O2 decomposed into 0.0400 mol of H2O and 0.0200 mol o
AleksandrR [38]
Description:

<span>"0.0400 mol of H2O2 decomposed into 0.0400 mol of H2O and 0.0200 mol of O2." 

This means that a certain amount of H2O2 (0.0400 mol) decomposed or was broken down into two components, 0.04 mol of H2O and 0.02 mol of O2. To examine the system, we need a balanced equation:

H2O2 ---> H2O + 0.5O2

The final concentrations of the system indicates that the system is in equilibrium. </span>
4 0
3 years ago
Other questions:
  • Describe the process illustrated in the diagram above. How many individuals would exist if the process continued for one more ge
    14·1 answer
  • What observation about light supported Einstein's theory?
    12·1 answer
  • A graduated cylinder contains 20.8 mL of water. What is the new water level, in milliliters, after 35.2 g of silver metal is sub
    5·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which of the following questions is most testable through scientific experimentation?
    9·2 answers
  • The human body receives sensory information from its surroundings. The body knows when food is warm or cold and whether an objec
    10·1 answer
  • Aluminum reacts with chlorine gas to produce aluminum chloride crystals. How many grams of aluminum chloride will be produced if
    8·1 answer
  • 1. define speed
    9·1 answer
  • One method used commercially to peel potatoes is to soak them in a solution of NaOH for a short time and then remove them from t
    10·1 answer
  • What do chemical and physical change have in common?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!