1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
musickatia [10]
3 years ago
7

Pricing the product low in order to stimulate demand and increase the installed base, then trying to make high profits on the sa

le of complements that are relatively high in price, is known as the:
Chemistry
1 answer:
Amanda [17]3 years ago
5 0

Answer:

razor and blade strategy

Explanation:

Razor and blade strategy -

It refers to the method of pricing , where the price of one of the item is reduced in order to increase the sale of another item , is referred to as razor and blade strategy .

It is a type of pricing tactics used by the company to indirectly earn profit for their goods and services .

Sometimes , fews goods are given free along with certain products , in order to earn profit .

Hence , from the given information of the question ,

The correct answer is razor and blade strategy .

You might be interested in
Differences and similarities between liquid and gas
timurjin [86]
<span>Various gases and liquids have different densities and combustion points.</span>
5 0
3 years ago
What element has 4 valence electrons and 5 electron shells?
marta [7]

Answer:  Tin (Sn)

Explanation:  The electron configuration for tin (Sn) is shown in the picture.  It's last electrons are:

5s^2 4d^10 5p^2

The valence electrons are in the 5th electron shell and include 2 each in the 5s and 5p orbitals.

8 0
3 years ago
The reaction between iron(II) oxide and carbon monoxide produces iron and carbon dioxide. How many moles of iron can be obtained
aleksandrvk [35]

Answer:

1.5 moles of Fe produced.

Explanation:

Given data:

Moles of FeO react = 1.50 mol

Moles of iron produced = ?

Solution:

Chemical equation:

FeO + CO       →       Fe + CO₂

Now we will compare the moles of ironoxide with iron.

                           FeO          :           Fe

                              1             :             1

                             1.5           :           1.5

Thus from 1.5 moles of FeO 1.5 moles of Fe are produced.                                    

5 0
3 years ago
What are the advantages and disadvantages of fission?
viktelen [127]

<u>Advantages of Nuclear Fission</u>

  • Nuclear fission provides cheapest energy . Almost 10% of electricity used in the world is obtained from the fission reaction
  • It offers a low-emission energy solution since there is no carbon dioxide gas emitted during the  nuclear fission reaction
  • A well controlled and maintained nuclear reactor can produce energy for 36 to 40 months so works for .
  • It is a reliable source of energy as energy is obtained from uranium which is available is plenty.
  • It provides very concentrations of energy as it can provide large amount of energy from small amount of fuel.
  • The reaction gives less annual mortality rate of any energy resource with 90 deaths per trillion kilowatt hours

<u>Disadvantages of Nuclear Fission </u>

  • It is dangerous and  also explosive.
  • It creates harmful and radioactive waste products.
  • It is not a renewable energy resource like solar and wind energy
  • It can develop long-term health issues for people exposed to then radioactive waves.
  • It involves high cost in installation of the reactors.
5 0
3 years ago
What must happen in a chemical reaction?
klasskru [66]
The anwser is atoms are destroyed
6 0
3 years ago
Other questions:
  • Calculate the volume of H2(g) at 273 K and 2.00 atm that will be formed when 275 mL of 0.725 M HCl solution reacts with 50.0 g Z
    5·1 answer
  • A chemist requires 0.450 mol na2co3 for a reaction. how many grams does this correspond to?
    10·2 answers
  • Convert the pressure 0.840 atm to mm Hg
    11·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What is the specific heat of a substance if 1560 cal are required to raise temperature of a 312 g substance by 15 degrees celsiu
    12·1 answer
  • My atomic number is 35.453.
    8·1 answer
  • Categorize the following reaction as an acid-base neutralization, precipitation, combination, decomposition, combustion, displac
    7·1 answer
  • Which term describes the molecule shown below?
    14·1 answer
  • The chemical equation, 2 Cr + 3 Fe(NO3)2 - 3 Fe + 2 Cr(NO3)3, is an
    15·1 answer
  • How many grams of nitric acid HNO₃, are required to neutralize (completely react with) 4.30 grams of Ca(OH)2 according to the ac
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!