1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex787 [66]
3 years ago
7

A beach ball has a mass of 5 g and a volume of 20 cm3. What is the object's density?

Chemistry
1 answer:
ivann1987 [24]3 years ago
3 0
Mass = 5 g

volume = 20 cm³

density = mass / volume

therefore:

D = m / V

D = 5 / 20

D = 0.25 g/cm³
You might be interested in
Chlorine has seven electrons in its valence shell. It accepts an electron to complete its octet and becomes a chlorine ion (Cl-)
KIM [24]
The correct answer here is B - when chlorine accepts an electron to complete its octet and becomes a chlorion ion it becomes an Anion. An anion is a negatively charged ion. Chloride ions are an important electrolyte within the body.
5 0
3 years ago
Entropy of a system decreases with decrease in Temperature T/F
Svet_ta [14]

Answer: The given statement is true.

Explanation:

Entropy means the measure of randomness present in a substance. That is, an increase in temperature will lead cause more motion in the particles of a substance more will be their kinetic energy.

As a result, there will occur more collisions due to which randomness of molecules will increase. Hence, there will be increase in entropy.

So, when we decrease the temperature then there will be decrease in motion of particles. As a result, lesser number of collisions will take place between them. Hence, degree of randomness will also decrease.

Thus, we can conclude the statement entropy of a system decreases with decrease in temperature, is true.

3 0
3 years ago
How many joules of heat are required to heat 125 g aluminum from 19.0°C to 95.5°C?
Katen [24]
The specific heat of aluminum is 0.902 J/gC. E=m*cp*delta T, or
125*0.902*(95.5-19)= 8630 J
3 0
3 years ago
Read 2 more answers
Test questions Accidently did this
PSYCHO15rus [73]
I don’t see any questions
6 0
2 years ago
Read 2 more answers
What are some of thr similarties of physical changes and chemical changes?
Marysya12 [62]
The similarities of physical and chemical changes is that both of those changes change the way the object looks by it's physical appearance. Also they use a type of element to change that object.
5 0
3 years ago
Other questions:
  • What effect does the use of an uncalibrated thermometer have on the boiling point?
    15·1 answer
  • What are weak bonds that allow flexibility in an enzyme
    9·1 answer
  • True or false? Even when soil is saturated with water, water is still available in small spaces.
    11·1 answer
  • What products are formed when CO2 and H2O react together?
    8·2 answers
  • Logging trees is often controversial. Why would some people support logging and some people not support logging?
    13·2 answers
  • What rate of reaction can be measured in the dark by determining the amount of oxygen gas consumed in a period of time?
    8·2 answers
  • Can someone please check my answer??!!
    6·1 answer
  • See if you can think of a way to prove that it is the oxygen in air, not nitrogen, that causes rusting.
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Scientists conducted an experiment to show whether the ability to see an object affects a person's idea of the mass of the objec
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!