1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
8

Choose the term that best matches the description given. Usually form superficial skin infections only ________.

Biology
2 answers:
Damm [24]3 years ago
6 0

Usually form superficial skin infections only A. Bacteria

slava [35]3 years ago
6 0

Answer:fungi

Explanation:

Fungi causes skin infections such as athletes foot, ringworm, jock itch, yeast infections among others. The symptoms of fungi infections includes redness of the skin, peeling or cracking if the skin, itching and burning.

You might be interested in
An organism's development is controlled by the genome of the zygote as well as by molecules from the mother that are in the cyop
STatiana [176]
<span>"Cytoplasmic determinates" are the proteins and rnas which perform a greatly significant role of vital importance in oocyte maturation, essential to organ formation of an organism's development very early on in the process which takes place in the mother's ovary.</span>
7 0
3 years ago
How and why does the epidermis produce new skin cells?
ArbitrLikvidat [17]

Answer:

About 95 percent of the skin cells in the epidermis are devoted to creating new skin cells in the lower two levels of the epidermis, which then cycle to the top layer to help form the stratum corneum. Eventually the dead cells of the stratum corneum flake off as new keratinocytes move up, and the cycle repeats itself.

Hope this answer is right!!

6 0
3 years ago
What sugar is found in a nucleotide of ribonucleic acid?
hoa [83]

Answer:

Ribose

Explanation:

Ribose, also called D-ribose, five-carbon sugar found in RNA (ribonucleic acid), where it alternates with phosphate groups to form the “backbone” of the RNA polymer and binds to nitrogenous bases.

8 0
2 years ago
How are complementary strands of DNA held together?
Damm [24]

Answer:

I believe it is D

Explanation:

Complementary base pairs are held together by hydrogen bonds. Adenine and Thymine go together. Cytosine and Guanine go together.

6 0
3 years ago
Aquifers are _______. a located below the water table b important sources of freshwater c located in the saturated zone d all of
iren2701 [21]

Answer:

The answer is D. all of the above

Explanation:

Aquifers are organisms that live in different areas of the water levels.

7 0
3 years ago
Read 2 more answers
Other questions:
  • WILL GIVE BRAINIEST!! PLEASE HELP ASAP!!
    5·1 answer
  • Abiotic components of a community include all of them except
    10·1 answer
  • Activated CD8 cells will mount a direct attack on target cells through the action of ____________ , which punch holes in membran
    5·1 answer
  • Compare the physical and chemical properties of a compound to those of the elements of which it is composed
    14·1 answer
  • You are planning to participate in a walkathon for a local charity. Which temperature would be most comfortable
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • what do you think are some human characteristics that reflect a common ancestry between non human primates and ourselves?
    10·1 answer
  • Why gene flow isn’t the cause of antibiotic resistance
    5·1 answer
  • Is squids shooting out ink behavioral adaptation?
    7·2 answers
  • Analyze the data table at the top of the page. What is the dependent variable?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!