1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firdavs [7]
3 years ago
8

What mass of aluminum is required if 40.0 grams of iron (III) oxide is to be completely consumed as

Chemistry
1 answer:
SVETLANKA909090 [29]3 years ago
5 0

Answer:

13.5

Explanation:

Molar mass of Fe2O3 = 2*56 + 16*3 = 112 + 48 =160 approximate value

Number of moles of Fe2O3 = mass/molar mass = 40/160 = 0.25 mol

The reaction is balanced. Fine

1 mol of Fe2O3--------> 2 mol of Al

0.25 mol--------> 0.25*2 = 0.5 mol of Al

Mass of Al required = Number of moles * Molar mass

= 0.5 * 27 = 13.5 g

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
What is homogeneous mixture?
Nataly [62]

A mixture is a portion of matter made up of two or more substances called constituents. Mixtures are the product of the mechanical joining of substances without change in chemical nature, and therefore, each constituent retains its properties.

the option 4

4 0
3 years ago
Please help me ASAP!!!
DENIUS [597]

Answer: Patrick was so sure he was a thief because why would you knock if it was your own room you would open the door. And he didn’t have a key to open the door.

Hope this helped

Explanation:

3 0
3 years ago
How can you get pure water from impure water ? Explain with Experiment ​
crimeas [40]

Answer:

Boil it.

Explanation:

If you mean how to clean water to sanitize it you have to boil it.

3 0
3 years ago
What is the molar mass off a substance?
ruslelena [56]
It is the mass of one mole of the substance.
4 0
3 years ago
Other questions:
  • Which is a function of the gallbladder
    12·1 answer
  • Ask 3 questions that will help you better understand the coronavirus
    12·1 answer
  • Which of the following describes an air mass with the symbol cT?
    14·2 answers
  • This characteristic of a sound wave changes as the volume of the sound wave changes
    12·2 answers
  • Why does water dissolve sugar ? Explain your answer !
    15·1 answer
  • Volume (at STP) of 5.2x10^26 molecules of CH4?
    10·1 answer
  • РЬ(он)2<br> +<br> Hсі —<br> Н2О +<br> РЬСl2
    7·1 answer
  • लेख्नुहोस् । (Deserts are very hot during the day and very cold<br> during the night. Give reason.)
    11·2 answers
  • Explain how a trait is passed down from one generation to the next
    14·2 answers
  • Scientists used a powerful telescope to discover the caloris crater on mercury
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!