1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iris [78.8K]
3 years ago
6

What is the Calcium iodine cation formula?

Chemistry
1 answer:
andreev551 [17]3 years ago
4 0

Molecular Formula: CaI2
You might be interested in
A gas occupies 800ml at a temperature of 27C. What is the volume at 132C?
pishuonlain [190]

V
1
​
/T
1
​
=V
2
​
/T
2
​

(900.0 mL) / (300.0 K) = (x) / (405.0 K); x = 1215 mL.

Change the 900 to 800, and the 300 to 27, then change the 405 to 132. And solve
3 0
3 years ago
Why should scientists control most possible variables in their experiments?
irina [24]
Scientists should control most possible variables in experiments to get the most valid and correct data. If many variables are included in experiments it is more difficult to interpret what is causing a different outcome.
8 0
3 years ago
Which of these expressions are correct variations of the Combined Gas Law?
mafiozo [28]

Answer:

Both

Explanation:

The combined gas law is also known as the general gas law.

From the ideal gas law we assume that n = 1;

So;

              PV  = nRT

 and then;

                  \frac{P_{1}V_{1}  }{T_{1} }  = \frac{P_{2}V_{2}  }{T_{2} }

   If we cross multiply;

                P₁V₁T₂   = P₂V₂T₁

  So;

         T₁ = T_{2} \frac{P_{1}V_{1}  }{P_{2} V_{2} }

Also;

         V₂  = V_{1} \frac{P_{1} T_{2} }{P_{2} T_{1} }

So from the choices both are correct

3 0
3 years ago
How many grams of calcium chloride are dissolved in 5.65 liters of a 0.11 m solution of calcium choride?
Julli [10]
C = 0.11 mol
V = 5.65 L
n = ???

n = C*V
n = 0.11 * 5.65
n = 0.622 mols

1 mol of CaCl2 = 40 + 2*35.5 = 111 grams
0.622 mol = x

x = 111 * 0.622
x = 69.0 grams CaCl2
4 0
3 years ago
A car travels 200 miles in 4 hours calculate the cars speed
Vaselesa [24]

Answer:

50 mph

Explanation:

To figure out how many miles per hour this car is going, we divide the distance traveled by the time it took.

200 ÷ 4 = 50

7 0
2 years ago
Other questions:
  • PLZ HELP QUICKLY!!
    7·1 answer
  • Which of the following is altered by a catalyst?
    10·1 answer
  • Explain the Heat Transfers that occurs in a hot plate?
    9·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • 20 POINTS!<br><br> what would be an example of an everyday household acid and base?
    13·2 answers
  • Temperature of the water to the nearest degree:___ °C
    14·2 answers
  • What is benzene and alcohol
    15·2 answers
  • The smallest atoms can themselves exhibit quantum-mechanical behavior. Calculate the de Broglie wavelength (in picometers) of a
    12·1 answer
  • This condition affects more than 25 million Americans. Often triggered by allergies, this condition causes a constriction of the
    7·1 answer
  • Atoms are the <br> piece of an
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!