1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marin [14]
3 years ago
9

What happens if an organism cannot carry out its life function?

Chemistry
1 answer:
Katyanochek1 [597]3 years ago
8 0

Answer:

<em><u>organisms cannot stay with out getting nutrients as they will not be able to repair them selves or produce energy.</u></em>

Explanation:

You might be interested in
A hydrate is determined to be 45.43% water and 54.57% CoCl. Find the chemical formula and name
patriot [66]

Answer:

Chemical formula is CoCl. 3H₂O

Explanation:

Data Given

Percentage of water = 45.43%

Percentage of CoCl. = 54.57%

Chemical Formula of the hydrates = ?

Solution:

First, find the mass of each of the part ( CoCl and water) in 100 g of the Compound.

Mass of CoCl = 28 + 35.5

Mass of CoCl = 63.5

Mass of H₂O = 18 g

Now find how many moles are there for each element in 100 g of compound

So,

The percentage will be count in grams for 100g in compound

Find the moles in total compounds

Formula Used for CoCl

mole of CoCl = mass of CoCl / Molar mass of CoCl

mole of CoCl = mole of  54.57 g / 63.5 g/mol

mole of CoCl = 0.859

Formula Used for H₂O

mole of H₂O = mass of H₂O/ Molar mass ofH₂O

mole of H₂O = 45.43 g / 18 g/mol

mole of  H₂O = 2.539

Now

To find the Chemical formula

Divide each one by the smallest number of moles

CoCl = 0.859 / 0.859

CoCl = 1

For H₂O

H₂O = 2.539  / 0.859

H₂O = 3

Multiply the mole fraction to a number to get the whole number.

CoCl =  1

H₂O  = 3

So,  

The Chemical formula is CoCl. 3H₂O

5 0
3 years ago
Calculate the freezing point of a solution 1.25 g benzene (C6H6) in 125 g of chloroform (CHCl3).
posledela

Answer:

The freezing point for the solution is -64.09°C

Explanation:

This problem can be solved, by the freezing point depression. This colligative problem shows, that the freezing point of a solution is lower than the freezing point of pure solvent.

ΔT = Kf.  m

ΔT = T° freezing pure solvent - T° freezing solution

Kf = Cryscopic constant, for chloroform is 4.68

T°freezing pure solvent = -63.5°C

m is mol/kg of solvent → molality

Let's determine the moles of benzene

1.25 g / 78 g/mol = 0.0160 mol

Let's convert the mass of solvent to kg

125 g . 1kg / 1000 g = 0.125 kg

m = 0.0160 mol / 0.125 kg → 0.128 m

Let's go to the formula to replace the data

-63.5°C - T° freezing solution = 4.68 °C/m . 0.128 m

T° freezing solution = - (4.68 °C/m . 0.128 m + 63.5°C)

T° freezing solution = - 64.09°C

3 0
3 years ago
Which type of rock is most likely to form because of high heat and pressure?
expeople1 [14]

Answer:

Metamorphic Rock

Explanation:

Metamorphic rocks are formed because of high heat and pressure . Metamorphic rocks form from heat and pressure changing the original or parent rock into a completely new rock. The parent rock can be either sedimentary, igneous, or even another metamorphic rock

6 0
3 years ago
Read 2 more answers
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
A gene is a to a chromosome as
Fofino [41]
I believe the answer would be A. A pea is to a pod
8 0
3 years ago
Other questions:
  • What is the acceleration of a ball with a mass of 0.40 kg is hit with a
    12·1 answer
  • What is a closed-loop system?
    10·1 answer
  • How many moles are in 18g of sugar(C6H12O6)
    13·1 answer
  • In his experiment on spontaneous generation, Louis Pasteur changed only one thing between his experimental groups: whether or no
    13·1 answer
  • In the technique of recrystallization, what is the 'mother liquor'? The mother liquor is the product in its liquid form. The mot
    9·1 answer
  • Which of the following is required for a properly labeled graph?
    7·2 answers
  • A polar covenant bond is likely to form between two atoms that ________.
    6·1 answer
  • I WILL GIVE BRAINLY IF U HELP ME WITH THIS LITTLE PASSAGE
    14·1 answer
  • SOMEONE PLZZ help me on this chemistry test I need to pass it to be able to get my grade up :(((
    14·1 answer
  • Why wasn’t sodium hydroxide used in the synthesis of divanillyl oxalate, instead of triethylamine?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!