1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ryzh [129]
3 years ago
11

A 13.0 kg iron weightlifting plate has a volume of 1650 cm3 . What is the density of the iron plate in g/cm3?

Chemistry
2 answers:
Salsk061 [2.6K]3 years ago
8 0
11.0 kg = (11.0 kg)(1000 g/kg) = 11000 g
(11000 g)/(1400 cm3) = 7.857 g/cm3
Simplified = 7.86 g/cm3
Oksi-84 [34.3K]3 years ago
5 0

Explanation:

It is known that density is the amount of mass divided by volume.

Mathematically,     Density = \frac{mass}{volume}

It is given that mass is 13.0 kg or 13000 g (as 1 kg = 1000 g). And, volume is 1650 cm^{3}.

Therefore, calculate the density as follows.

                    Density = \frac{mass}{volume}

                                 = \frac{13000 g}{1650 cm^{3}}    

                                 = 7.87 g/cm^{3}

Thus, we can conclude that density of the given iron plate is 7.87 g/cm^{3}.

You might be interested in
ILL GIVE POINTS TO WHOEVER HELPS!!!
kirza4 [7]
Yeah no one is gonna read all that babe.
4 0
3 years ago
{Plz answer} Thank you!
Dafna11 [192]

The Answer to your question would be A

8 0
3 years ago
Read 2 more answers
What volume of an hcl solution with a ph of 1.3 can be neutralized by one dose of milk of magnesia?
kvv77 [185]

274 mL H3 O+ and fully neutralized

It will take one teaspoon of Mg(OH)2 to completely neutralize 2.00×10^2mL  of H3O+.

<h3>What is the purpose of milk of magnesia?</h3>
  • For a brief period of time, this medicine is used to relieve sporadic constipation.
  • It is an osmotic laxative, which means that it works by drawing water into the intestines, which aids in causing bowel movement.
<h3>What dosage of milk of magnesia is recommended for constipation?</h3>
  • Take Milk of Magnesia once day, preferably before bed, in divided doses, or as prescribed by a physician.
  • suggested dosage: 30 mL to 60 mL for adults and kids 12 years of age and older. 15 mL to 30 mL for children aged 6 to 11 years.

learn more about milk of magnesia here

brainly.com/question/15178597

#SPJ4

the question you are looking for is

People often take milk of magnesia to reduce the discomfort associated with acid stomach or heartburn. The recommended dose is 1 teaspoon, which contains 4.00x 10^{2} mg of Mg(OH)_2. What volume of an HCl solution with a pH of 1.3 can be neutralized by one dose of milk of magnesia? If the stomach contains 2.00x10^{2}mL of pH 1.3 solution, is all the acid neutralized? If not, what fraction is neutralized?

7 0
1 year ago
The half of the moon facing the sun is always lit, but the different phases happen because:
zvonat [6]

Answer:

we only see parts of the lit side as the moon goes around the earth

Explanation:

Unlike the sun, the moon orbits the Earth. This is the reason why we see the <em>different phases of the moon.</em> The reflection of the moon is being illuminated back to us with the help of the sun. So, as the moon circles the Earth, we only see parts of the lit side. Such changes helps us see the moon in different phases such as<em> </em>the <em>Third Quarter, Crescent, New Moon, Full Moon, etc.</em>

For example, during "Full Moon," <em>the moon's entire face is lit up by the sun</em>. Thus, we see the entire moon's lit portion.

Thus, this explains the answer.

7 0
3 years ago
Predict the sign of ΔSsys for each of the following processes. Which are positive? (a) Gasoline vapors mix with air in a car eng
OLEGan [10]

Answer:

Positive: a and b

Negative: c

Explanation:

The entropy (S) is the measure of the randomness of the system, and it intends to increase. The randomness can be determined by the energy of the molecules, their velocity and how distance they are between the other molecules.

When the entropy increases, ΔS is positive, when the entropy decreases, ΔS is negative. So, when gasoline mix with air in a car engine, the process intends to continue, the randomness increases and ΔS is positive. When hot air expands, the distance between the molecules increases, so ΔS is positive.

But, when humidity condenses, the molecules stay closer, so there's a decrease in the randomness, then ΔS is negative.

6 0
3 years ago
Other questions:
  • What is a control group and is it always needed in an experiment?
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Measurements show that the enthalpy of a mixture of gaseous reactants increases by 243.kJ during a certain chemical reaction, wh
    5·1 answer
  • A box is pushed down at an angle of 32 degrees on a rough surface. The box moves to the right.
    9·1 answer
  • What would be good types of info to put in a timeline
    7·1 answer
  • Which of these 2A elements has the largest atomic radius?
    11·1 answer
  • The Bohr model of the atom suggest that the protons and neutrons are found in the nucleus and the electrons orbit the nucleus mu
    9·1 answer
  • How much energy (in J) is lost when a sample of iron with a mass of 28.3 g cools from 66.0 degrees celsius to 24.0 degrees celsi
    14·1 answer
  • How can one separate and collect the solvent from a salt solution​
    7·1 answer
  • Predict which of the substances, NH3, N2, CH2Cl2, Cl2, CCl4 has
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!