1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ra1l [238]
3 years ago
11

Mirrror metal and wood are the exaple

Chemistry
1 answer:
Nikitich [7]3 years ago
4 0
Mirror, metal and wood are examples of objects
You might be interested in
How does one recognize a redox reaction?
nika2105 [10]

Answer:

A.

Explanation:

A redox reaction is a reaction when oxidation states (or numbers) change during reaction.

3 0
3 years ago
Give four reasons why afertile soil is not necessarily productive​
abruzzese [7]

Answer:

During cellular respiration animal cells combine oxygen with food molecules to release energy to live and function. Remember that cellular respiration produces carbon dioxide as a waste product. Animals use energy to grow, reproduce, and to function. They release the carbon dioxide into the air as a waste product

Explanation:

5 0
3 years ago
How many moles of aluminum are equivalent to 4.816x10^24 atoms? 12.5 8 1.25 0.8
kotegsom [21]

Answer:

8

Explanation:

1 mole = 6.02 × 10²³ atoms

? moles = 4.816 × 10²⁴ atoms.

? Moles = 4.816 × 10²⁴ ÷ 6.02 × 10²³

? Moles = 8 moles

8 moles of aluminum = 4.816 × 10²⁴

4 0
3 years ago
Read 2 more answers
Please help. thank youuuu
Dmitry [639]

Answer:

'See Explanation

Explanation:

Determine the [OH−] , pH, and pOH of a solution with a [H+] of 9.5×10−13 M at 25 °C.

Given [H⁺] = 9.5 x 10⁻¹³M => [H⁺][OH⁻] = 1.0 x 10⁻¹⁴ => [OH⁻] = 1.0 x 10⁻¹⁴/9.5 x 10⁻¹³ = 0.0105M

pH = -log[H⁺] = -log(9.5 x 10⁻¹³) = - (-1202) = 12.02.

pOH = -log[OH⁻] = -log(0.0105) = -(-1.98) = 1.98

Now you use the same sequence in the remaining problems.

6 0
2 years ago
Based on the passage, what is the structure of the product of the reaction between 8-hydroxyquinoline-5 sulfonate and hrp?.
Mashutka [201]

A because the end result of this reaction is a radical created by the oxidation of an aromatic amine's or phenol's ring substituent. The hydroxyl group of a phenol acts as the ring substituent in this situation.

<h3>Which two enzyme types are required for the two-step process of converting cytosine to 5 hmC?</h3>
  • The methyl group is transferred to cytosine in the first stage, and it is then hydroxylated in the second step.
  • Therefore, a transferase and an oxidoreductase are the two groups of enzymes required.

<h3>Which kind of interaction between proteins and the dextran column material is most likely to take place?</h3>
  • Hydrogen bonding because the glucose's OH would form an H-bond with any exposed polar side chains on a protein surface.

<h3>Two out of the four proteins would adhere to a cation-exchange column at what buffer pH? </h3>
  • Only positively charged proteins can bind to a cation-exchange column, and this can only happen when the pH is lower than the pI.
  • Proteins A and B would both be positively charged at pH 7.0.

To learn more about hydroxyquinoline visit:

brainly.com/question/26102339

#SPJ4

4 0
2 years ago
Other questions:
  • The passage refers to solutions as homogeneous mixtures. what is the best definition of a homogeneous mixture?
    9·1 answer
  • 16) The mass number of an element whose atoms have 12 protons and 13 neutrons is_
    13·1 answer
  • HELPPP
    7·1 answer
  • How many moles of carbon are there in a 0.70 g (3.5 carat) diamond?
    13·1 answer
  • Which statement describes how stars are born? Check all that apply
    7·2 answers
  • Which car traveled a greater distance? Car A traveled 25 miles/hour for 3 hours, stopped for an hour, and then traveled 35 miles
    12·1 answer
  • Which of the following statements best describes the number of neutrons in an atom?
    12·1 answer
  • A__ is two or more substances that are together in the same place but are not chemically ( combined.​
    14·1 answer
  • What is the frequency of an electromagnetic wave with a wavelength of 1.0 x 10' m?
    12·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!