1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natta225 [31]
2 years ago
13

Any moving object has _______________ energy A.kinetic B.potential C.gravitational potential

Chemistry
2 answers:
nignag [31]2 years ago
7 0

Answer:

Kinetic

Explanation:

potential means it has the POTENTIAL to move, gravitational potential energy is when an object isn't moving but the it turns into gravitational kinetic energy since gravity causes it to move. since the object in question is already in motion it proves kinetic energy as the answer.

zysi [14]2 years ago
3 0
Any moving object has kinetic energy
You might be interested in
How many atoms are in 163 g of calcium?
I am Lyosha [343]
<span>Avogadro's number represents the number of units in one mole of any substance. This has the value of 6.022 x 10^23 units / mole. This number can be used to convert the number of atoms or molecules into number of moles.

163 g Ca (1 mol / 40.08 g) ( </span>6.022 x 10^23 atoms / 1 mol ) = 2.45 x10^24 atoms Ca
8 0
3 years ago
Read 2 more answers
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Does the universe have air in it between the galxies in it
fenix001 [56]

Answer:

No it does not space does not have oxygen and air is caused by oxygen

hey but this was a really interesting question to ask tho

Explanation:

4 0
2 years ago
C2H4(g) + H2(g) mc030-1.jpg C2H6(g) Which change would likely cause the greatest increase in the rate of the reaction?
Vinil7 [7]
The reaction is a hydrogenation reaction of an alkene, and its equation is:
C₂H₄(g) + H₂(g) → C₂H₆(g)
Therefore, this reaction can be sped up just as any other irreversible reaction may have its rate increased, by increasing temperature and pressure to increase the effective collisions of molecules.
5 0
3 years ago
Read 2 more answers
The volume of a sample of gas at 273 K is 200. liters. If the volume is doubled at constant pressure, what will be the new tempe
gayaneshka [121]

Answer:

New temperature = 546 K

Explanation:

Given that,

Initial volume, V = 200 L

Initial temperature, T = 273 K

We need to find the new temperature if the volume is doubled.

The relation between temperature and volume is direction. If volume is doubled, it means the temperature gets also doubled.

New temperature of the gas = 2(273) = 546 K

8 0
3 years ago
Other questions:
  • When determining the formula for a compound, it is important to know the valence numbers of each element. Suppose you want to wr
    9·1 answer
  • All of the following are indicators of chemical change except…
    10·1 answer
  • Why is only one diastereomer formed in this reaction? Relate your answer to the mechanism you drew. b) If you used cis-stilbene
    10·1 answer
  • Structure of tetrazine
    7·1 answer
  • Caculate the number if moles of the following: 800. g of Ca
    14·1 answer
  • Use Hess's Law or the summation equation to calculate the ΔHrxn. Round to the nearest tenth!!
    11·1 answer
  • A brown rabbit is easily hunted and killed in an arctic ecosystem. Which would be expected to appear most often future generatio
    7·1 answer
  • Can someone please help I don’t understand this. I’ll mark you as brainliest if correct!!
    6·1 answer
  • Which of the following conversion factors would be used to calculate the number of moles of Cl2 produced if 11 moles of HCl were
    8·1 answer
  • Two cars A and B are moving in opposite directions with the velocity of 20m/s and 6m/s respectively Calculate the relative of ca
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!