1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bekas [8.4K]
3 years ago
15

Help me out hear i need help

Chemistry
1 answer:
____ [38]3 years ago
6 0

Answer:

Explanation:

i cant see the attachment

You might be interested in
A drought is best defined as
Lapatulllka [165]
A drought is a period of drier-than-normal conditions that results in water-related problems.<span> When rainfall is less than normal for several weeks, months, or years, the flow of streams and rivers declines, water levels in lakes and reservoirs fall, and the depth to water in wells increases.</span>
5 0
3 years ago
Periodic Table: Why are group 1A elements called alkali metals?
FrozenT [24]

Answer:

Explanation:

The elements in Group I of the periodic table are called alkali metals. They are called alkali metals because they react with water to form alkali solutions. These metals are very reactive; hence they have to be stored under oil to protect them from corrosion by air and waterwaterwater

5 0
2 years ago
Nitrogen dioxide is a red-brown gas that is responsible for the color of photochemical smog. What is the volume of 1 mol of nitr
Ray Of Light [21]
B ideal gas has a volume of 22.4
5 0
3 years ago
What are two systems that use radio waves
Goshia [24]
Mobile radio communication
Broadcasting
Navigation systems
7 0
3 years ago
Homeostasis means maintaining
Zielflug [23.3K]

Answer:

Homeostasis is the tendency to resist change in order to maintain a stable, relatively constant internal environment. Homeostasis typically involves negative feedback loops that counteract changes of various properties from their target values, known as set points.

Explanation:

So D. Glad to help! :D

4 0
3 years ago
Read 2 more answers
Other questions:
  • A carbon compound with a covalently bonded chlorine or bromine is called _____. an amide an halocarbon an alcohol an aldehyde
    10·1 answer
  • What do scientist use to measure the mass of a substance
    12·1 answer
  • What is the difference between atom A and atom B? A - 1s22s22p63s1 B - 1s22s22p65s1 Answers to choose from: 1) Atom B has lost s
    13·1 answer
  • Is it an animal of plant cell?
    15·1 answer
  • Which wave has the longest wavelength ?Shortest?
    10·2 answers
  • What is the positively charged nucleus composed of?
    13·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Halp me need help with this question
    11·1 answer
  • Given the following chemical formula:
    12·1 answer
  • If an ion had a charge of (-3), how many valence electrons could be expected
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!