1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bonufazy [111]
3 years ago
7

Females do not develop bulging muscles or experience muscle definition as males do because of testosterone, which is the female

Health
2 answers:
Crank3 years ago
5 0

Answer:

true

Explanation:

zhenek [66]3 years ago
4 0
False testosterone is a males hormone
You might be interested in
Explain how eating fruits and vegetables to support dietary fiber intake can help with hydration and immune function.
ArbitrLikvidat [17]
Fruits and vegetables are juicy and can hydrate you a little bit. some have special minerals, vitamins and things like that that help your immune system and they contain fiber that helps your body too.
3 0
4 years ago
Which is a complex carbohydrate found in plants? amino acid, cholesterol, saturated fat, or fiber? Ill give 20 points
riadik2000 [5.3K]

Answer:

One example of a complex carbohydrate found in plants is starch.

Explanation:

they use it to store glucose as food for energy later

5 0
4 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
4 years ago
How many people worldwide are newly infected with HIV each day?
Pie
C. More than 5,000

5,600 people are infected with HIV everyday.
8 0
3 years ago
What is the correct definition for "target heart rate range"? A. Number of beats per minute the heart drops after exerc...
Morgarella [4.7K]

Answer:

the rate of which your heart should be beating to attain or persue a goal such as exercise to loose weight.

6 0
3 years ago
Other questions:
  • The people of Treasure Island Beach have been struck with a rash that seems to be infecting almost everyone in town. The staff o
    9·1 answer
  • When there is not a certified athletic trainer present, an athlete suffering from heat-related problems should be removed from p
    10·1 answer
  • ___________ training is a way of performing muscular endurance exercises that involves changing stations with short breaks in be
    5·1 answer
  • Which statment about tobacco is true
    10·1 answer
  • Select the correct answer. What is the proper way to use weights? OA Use quick movements OB. the weights quickly O C. Use smooth
    13·2 answers
  • The purpose of the cover letter is to _____.
    10·2 answers
  • Which two elements support the written content on a slide
    5·1 answer
  • A person's location on the health continuum is constant throughout one's life.<br> True or False?
    9·2 answers
  • Mr. Gomez is a waiter &amp; notices a guest feeling ill after eating bread pudding and realizes the guest is having an allergic
    15·2 answers
  • What is LGBTQI stand for​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!