1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SCORPION-xisa [38]
3 years ago
10

A student makes a sound by blowing into the mouth of an empty soda bottle. How could the student make the sound louder?

Chemistry
1 answer:
Alja [10]3 years ago
5 0

Answer:

Increase the amplitude by blowing with more force.

Explanation: I answered this.

You might be interested in
How do elements of the periodic table affect economy
Bess [88]
They don’t, what you even on about
7 0
3 years ago
PLEASEEE HELP NOW!!! 60 BRAINLIEST!!
algol13

Answer:

When the net force is balanced

Explanation:

Remeber taking physics and doing this

8 0
3 years ago
Read 2 more answers
A student sets up the following equation to convert a measurement. (The stands for a number the student is going to calculate.)
Crank

Answer:

0.090 J/(mmol·°C) × (1000 mmol/mole × 1 kJ/(1000 J)) = 0.090 kJ/mole

Explanation:

The unit of conversion from kilo-Joules to Joules is given as follows;

1000 Joules = 1 kilo-Joule

The unit of conversion from milimoles to moles is given as follows;

1000 milimoles = 1 Mole

Therefore, we have

The value of the given expression is 0.090 J/(mmol·°C) × 1000 mmol/mole × 1 kJ/(1000 J) = 0.090 kJ/mole

0.090 J/milimole = 0.09 kJ/mole.

3 0
3 years ago
Is a tooth made out of matter or not matter?
LenKa [72]

Human teeth are made up of four different types of tissues.

4 0
3 years ago
Why are there 2 bonds holding the oxygen atoms together?​
tino4ka555 [31]

Answer:

Because Oxygen shares 2 electrons with mutual bond interaction forming covalent bond . thus it is diatomic due to K shell 2 electrons mutual sharing .

Explanation:

8 0
3 years ago
Other questions:
  • Suppose a mountain range is made up of 18 mountains, each mountain has
    6·1 answer
  • You are asked to determine the identity of an unknown liquid and can measure only one physical property. you heat a liquid and r
    7·1 answer
  • The basis of life on earth is the photosynthesis reaction. Balance the reaction:
    13·1 answer
  • What is the balanced equation for KOH+CO2—>K2CO3+H2O
    12·1 answer
  • Consider the following comparison.
    14·2 answers
  • Determine the frequency of light (use speed of light) of 8.5 x 10^-7
    8·1 answer
  • What two subatomic particles have to be different in order to have an ion?
    6·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • How many grams of CO2 are produced from 18.6 g of oxygen gas?
    10·1 answer
  • One sentence describing the difference between pure substances and mixtures.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!