1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crank
3 years ago
5

Determine the molar mass of Cao​

Chemistry
1 answer:
e-lub [12.9K]3 years ago
6 0

Answer:

Molar mass of CaO

(40 + 16)g

= 56g

hope it helps you

You might be interested in
Group of students is investigating whether the force of friction depends on the nature of the surfaces in contact. The students
olya-2409 [2.1K]

Answer:

Distance traveled.

4 0
3 years ago
Read 2 more answers
What kind of cells do animals have?
Andrei [34K]

Answer:Animal cells are eukaryotic cells that have both a membrane-bound nucleus and other membrane-bound organelles.

Explanation:Animal cells are eukaryotic cells that have both a membrane-bound nucleus and other membrane-bound organelles. These organelles carry out specific functions that are needed for the normal functioning of the cell. Plant and animal cells are similar in that they are both eukaryotic and have similar types of organelles

7 0
3 years ago
If an object has a density of 0.55 g/mL, what is its density in cg/L?
otez555 [7]

if              1 g is equal to 100 cg

then  0.55 g are equal to X cg

X = (0.55 × 100 ) / 1 = 55 cg

The density of the object is 55 cg/L.

7 0
3 years ago
Read 2 more answers
Both the oxygen you need to breathe and ozone are gases made only of oxygen. So why can't you survive by breathing ozone?
marshall27 [118]

Answer/Explanation: Two atoms of oxygen form the basic oxygen molecule--the oxygen we breathe that is essential to life. The third oxygen atom can detach from the ozone molecule, and re-attach to molecules of other substances, thereby altering their chemical composition.

8 0
2 years ago
What is a dark mysterious and non-nicotine mineral containing sample of a very common silicate? It's geology actually.
Oxana [17]
Orthoclase & Plagioclase...
4 0
3 years ago
Other questions:
  • How do simple distillation and fractional distillation differ?
    9·1 answer
  • Been struggling with this question for a while, some help will be appreciated :)
    5·1 answer
  • What electron transition represents a gain of energy?
    14·1 answer
  • Inches of mercury (inHg) is commonly used as unit of atmospheric pressure. It indicates the height of Hg (in inch) that atmosphe
    13·1 answer
  • You notice something is growing in a 100ml pot of liquid soap. You take 1ml of this liquid soap and perform a serial dilution an
    14·1 answer
  • Gaseous water molecules condense when they _______. Liquid water molecules evaporate when they _______.
    15·1 answer
  • Scientists are studying compounds in a newly discovered rain forest plant. the plant produces an unusual substance that local pe
    8·2 answers
  • The heat of combustion of oleic
    7·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Please help and show work will be picking brainliest
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!