1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sladkaya [172]
3 years ago
10

Which word best describes the upper mantle a) liquid, b) solid, c) plastic-like

Chemistry
2 answers:
Valentin [98]3 years ago
8 0

Answer:

I believe the answer is B )solid

Explanation:

It can bend like plastic ,  although the asthenosphere is softer than the rest of the mantle, it's still solid.

sergejj [24]3 years ago
4 0

Answer:

B)solid

Explanation:

its usually the layer above the core which is liquid

You might be interested in
Use the following equation to answer the questions below:
Gala2k [10]

Explanation:

The equation of the reaction is given as;

Be + 2HCl → BeCl2 + H2

What is the mass of beryllium required to produce 25.0g of beryllium chloride?

1 mol of Be produces 1 mol of BeCl2

Converting to mass;

Mass = Molar mass  *  Number of moles

9.01g of Be produces 79.92g of BeCl2

xg of Be produces 25g of BeCl2

Solving for x;

x = 25 * 9.01 / 79.92

x = 2.82 g

What is the mass of hydrochloric acid required to produce 25.0g of beryllium chloride? g

Converting 25.0g of beryllium chloride to moles;

Number of moles = Mass / Molar mass

Number of moles = 25 / 79.92 = 0.3128 mol

2 mol of HCl produces 1 mol of BeCl2

x mol of HCl would produce 0.3128 mol of BeCl2

solving for x;

x = 0.3128 * 2 = 0.6256 mol

Converting to mass;

Mass = 0.6256 * 36.5 = 22.83 g

What is the mass of hydrogen gas produced when 25.0g of beryllium chloride is also produced? g

25g of BeCl2 = 0.3128 mol of BeCl2

From the equation;

1 mol of H2 is produced alongside 1 mol of BeCl2

This means;

0.3128 mol of H2 would also be produced alongside 0.3128 mol of BeCl2

Mass = Number of moles * Molar mass

Mass = 0.3128mol * 2.0159 g/mol = 0.6306 g

3 0
3 years ago
. When a person weighs himself in pounds, which system of measurement is he using?
timama [110]

Answer:

Weight is a 'force' and in the imperial system, it is measured in pounds-force (lbf or lbf). You might hear this term used together with the term 'slug'. A slug has a mass of 32.174049 lb.

Explanation:

8 0
3 years ago
Imagine an alternate universe where the value of the Planck constant is 6.6207 x 10^-36 J*s.
hoa [83]

Answer:

See explanation

Explanation:

According to Louis de Broglie, particles could exhibit wavelike properties and have an associated wavelength.

Now for a turtle with a mass of 450. g, 29. cm long, moving at 2.7 cm/s, recall that we can only describe a by quantum mechanics when the body is very small and its associated wavelength is large.

This object has a large mass, hence it is discussed by classical rather than quantum mechanics

4 0
3 years ago
SOMEONE EXPLAIN THIS TO ME?!?!
labwork [276]

Answer:

Determining the pH of substances such as purple grape juice and catsup using test strips can be difficult. Why?

Explanation:

Due to the tartaric acid present in these substances, this is a weak acid and is the predominant type of acid in grapes.

pH meters for these substances, measure the total acidity of the sample and convert it into tartaric acid concentration; The test strips are a qualitative method of measurement and their result can give different opinions.

7 0
3 years ago
Read 2 more answers
If Oxygen were to gain 2 electrons, the new electron configuration for the oxide ion
Naddika [18.5K]
It would be most similar to neon. it wouldn’t be sulfur because that’s in the same group as oxygen and has the same number of electrons. and carbon has less than that so the only one that makes sense is neon
5 0
3 years ago
Other questions:
  • What type of chemical reaction is AgNO3(aq)+KCL(aq) AgCL(s)+KNO3(aq)​
    5·1 answer
  • Which of the following is a balanced chemical equation?Which of the following is a balanced chemical equation?
    11·1 answer
  • The standard reduction potentials for the Ag+|Ag(s) and Zn2+| Zn(s) half-cell reactions are +0.799 V and -0.762 V, respectively.
    6·1 answer
  • What is the empirical formula for a compound that is 29.44\% calcium, 23.55% sulfur, and 47.01% oxygen? This compound is a commo
    10·1 answer
  • Is roasting a marshmallow a Chemical or Physical reaction?
    6·2 answers
  • How much more basic is a solution with pH 10 than a solution with pH 8?
    12·2 answers
  • Shameeka is studying for an exam. She took the notes below about calcium and chlorine, which are known to form ionic bonds. Calc
    12·2 answers
  • What is the chemical formula for Fluorine trisulfide ?
    13·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Does the percent by mass of each element in a compound depend on the amount of that element used to make the compound? Explain.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!